Magnus Carlsen's Coach Speaks Up on Cheating Drama

Sdílet
Vložit
  • Äas pÅ™idán 19. 09. 2022
  • Magnus Carlsen's coach and friend GM Peter Heine Nielsen is interviewed about Magnus's resignation during the Julius Baer Generation Cup.
    👕 MERCH ► streamlabs.com/gmhikaru/merch
    â™Ÿï¸ LEARN CHESS & PLAY WITH ME â–º go.chess.com/hikaru
    🎠GIVE 💎 CHESS ► www.chess.com/membership/gift...
    🎬 CLIPS CHANNEL ► czcams.com/users/GMHikaruCli...
    ðŸŽžï¸ MORE GMHIKARU â–º czcams.com/users/moregmhikar...
    💜 TWITCH ► / gmhikaru
    💖 INSTAGRAM ► / gmhikaru
    🦠TWITTER ► / gmhikaru
    ✨ TIKTOK ► / hikarugm
    💛 DISCORD ► / discord
    💙 FACEBOOK ► / gmhikaru
    💚 SUPPORT ► streamlabs.com/gmhikaru
    🖤 SUPPORT MY ORG Misfits Gaming ► us-shop.misfitsgaming.gg/
    🤣 REDDIT ► / hikarunakamura
    â”â”â”â”â”â”â”â”â”â”â”â”â”
    🎥 Edit and 🎨 Thumbnail ► Jaron / jaroniscaring
    👌Channel Management ► Team Hikaru
    📧 Business inquiries ► TeamHikaru@WMEAgency.com OR GMHikaruBiz@yahoo.com
    #gmhikaru #chess #chessdrama
  • Hry

Komentáře • 1,1K

  • @thepreacher621
    @thepreacher621 PÅ™ed rokem +2628

    Clicked this vid quicker than Magnus resigned

  • @houseofleaves126
    @houseofleaves126 PÅ™ed rokem +2181

    “Most chess grandmasters barely have education because we actually have to care about chess†is one of the funny things I’ve heard a GM say

    • @marijntenvelde8106
      @marijntenvelde8106 PÅ™ed rokem +111

      MVL has a bachelor's in applied mathematics

    • @hikikomori9544
      @hikikomori9544 PÅ™ed rokem +88

      Unintentional roast of the century

    • @adamleckius2253
      @adamleckius2253 PÅ™ed rokem +78

      Lol, Hikaru of course misunderstood this, he obviously meant education *on cheating in chess* specifically

    • @hi-ve1cw
      @hi-ve1cw PÅ™ed rokem +5

      @@marijntenvelde8106 who's MVL?

    • @ronniemacdonald2768
      @ronniemacdonald2768 PÅ™ed rokem +22

      He's not wrong.

  • @TheRedeemed117
    @TheRedeemed117 PÅ™ed rokem +2790

    This guy is awesome at saying nothing, but implying everything.

    • @Robcoz
      @Robcoz PÅ™ed rokem +122

      Like politicians , no clear cut answer just some random bs to confuse people even more. 🤣

    • @ChintanCG
      @ChintanCG PÅ™ed rokem +53

      That's why he's magnus's coach

    • @arthurhaag9434
      @arthurhaag9434 PÅ™ed rokem +94

      @@Robcoz you Said the exact oposite of what the comment said

    • @blazeyy1357
      @blazeyy1357 PÅ™ed rokem +5

      ONG 💀

    • @Unpug
      @Unpug PÅ™ed rokem +1

      Absolutely

  • @tactful6908
    @tactful6908 PÅ™ed rokem +1594

    The coach has mastered the politician answering technique

    • @Jeffrey_Tyler
      @Jeffrey_Tyler PÅ™ed rokem +87

      That was the LITERAL opposite of the politician answering technique. Politicians spin a question into a completely different talking point. The coach answered the questions as honestly as he possibly could. Or maybe I'm only thinking of American politicians, since they are all I know.

    • @LFSPharaoh
      @LFSPharaoh PÅ™ed rokem +25

      I think diplomacy is more accurate. I know what you mean though, it’s riff in the chess world especially the answers from players to the reporters.
      Edit: I think rife was what I meant

    • @RoughSmoothie
      @RoughSmoothie PÅ™ed rokem +3

      Well, he's married to one, after all 😄

    • @ni9274
      @ni9274 PÅ™ed rokem +3

      He talk a lot to get over quickly with the interview but without really telling us anything.
      It’s basic politician tactics when they are asked about embarrassing stuff.

    • @aaronmarchand999
      @aaronmarchand999 PÅ™ed rokem +1

      I don't understand, he said in the last tournament, Magnus was angry after Hans' interview where he insulted him, so he responded with a passive-aggressive "force" that would derail Hans' chances at winning the tournament, and he succeeded brilliantly... art of war, sacrificing oneself to destroy one's enemies, aka a kamakazi psychological attack. And now this time with the quick resign he has a similar plan, but it's too early to reveal the overall strategy publicly

  • @dillonferreira3529
    @dillonferreira3529 PÅ™ed rokem +719

    Interviewer : **asks anything**
    Carlsen's coach : If I speak I am in big trouble.

    • @c99kfm
      @c99kfm PÅ™ed rokem +6

      @@JoeyCakes3 Danish, living in Lithuania.

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem

      @@c99kfm Don't worry about him, he's racist.

    • @Aquino42503
      @Aquino42503 PÅ™ed rokem +3

      I am jose mourinho

    • @dannygjk
      @dannygjk PÅ™ed rokem

      @@JoeyCakes3 😂 You made me wonder if I'm an idiot for listening to this video.

    • @bethanalpha4544
      @bethanalpha4544 PÅ™ed rokem

      in big, big trouble. And I don't want to be in big trouble

  • @Grand-Massive
    @Grand-Massive PÅ™ed rokem +386

    Speaks up on cheating drama: "I'm not really going to tell you anything there."

    • @Wulk
      @Wulk PÅ™ed rokem +17

      she should have replied "then what are you doing here??" lmao

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +15

      @boss sauce The fact that you couldn't even spell his name right shows how much you know about the situation.

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +10

      @boss sauce It's just you that's pretending to laugh.

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +10

      @boss sauce What saddens me is that you're a troll but you're not even good at it.

    • @vanillaghetto
      @vanillaghetto PÅ™ed rokem +2

      @boss sauce He was 19, not 17. And he admitted to being caught cheating multiple times online when he was 16, and in an online tournament when he was 12. How about you stick to the facts.

  • @valentinocozzi
    @valentinocozzi PÅ™ed rokem +511

    Magnus' coach basically said something without saying anything

    • @slink66
      @slink66 PÅ™ed rokem +6

      or just the opposite

    • @alekhinesgun9997
      @alekhinesgun9997 PÅ™ed rokem +24

      You basically reiterated every other comment without copying verbatim every other comment

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +1

      I really don't think that he did. And if he did, what exactly did he say?

    • @dna6496
      @dna6496 PÅ™ed rokem +2

      @@alekhinesgun9997 but its true though so you have no point

    • @cdunne1620
      @cdunne1620 PÅ™ed rokem

      ..no not at all, it’s just that the majority are spewing their illogic everywhere whereas this guy is intelligent and therefore restrained

  • @WELLZY_
    @WELLZY_ PÅ™ed rokem +125

    i can see how magnus’ defence is so strong, this guy blocked all these attacks lol

  • @elijahmitchell-hopmeier182
    @elijahmitchell-hopmeier182 PÅ™ed rokem +634

    "Most chess grandmasters don't have an education because we actually have to care about chess." ~Peter Nielsen

    • @spectralanalysis
      @spectralanalysis PÅ™ed rokem +4

      Inb4 people say "cope"

    • @omargodinez7256
      @omargodinez7256 PÅ™ed rokem +16

      Why is this controversial to say? It is true. Do people seriously believe being good at chess replaces professional expertise on other things?

    • @elijahmitchell-hopmeier182
      @elijahmitchell-hopmeier182 PÅ™ed rokem +4

      @@omargodinez7256 He's correct about the education being one-sided in a chess grandmaster, but a specialization in one specific skill (chess) does not necessarily mean that they are completely uneducated and somewhat understates the fact that many chess super GMs are just, simply put, geniuses.
      If anything, it should be taken as the joke it is. It's a subversion of the expectation of the so-called omniscient genius. It's comedy first and controversy second, and I don't think most people would take it any other way.

    • @omargodinez7256
      @omargodinez7256 PÅ™ed rokem +5

      @@elijahmitchell-hopmeier182 I am inclined to believe he means it seriously in some level though, because it is very true. I am not saying chess geniuses are idiots at anything else, but it takes more than genius to be competent at things as technical as cheat detection. I also think the dismisal of the cheat detection expert's view because he's "just an IM" is very ignorant, arrogant and short-sighted. I think I just find the idea that a chess genius is somehow the pinacle of human intellect is a bit pathetic, to be honest.

    • @Prometheus4096
      @Prometheus4096 PÅ™ed rokem +6

      @@omargodinez7256 *It is utter stupidity on Nakamura's and Nielsen's side. They admit they don't understand basic statistics because they never even got a basic education and that they should be humble. But just after saying that, they claim that Ken Regan's method somehow must be flawed, even though they didn't spend any time understanding it, and though they admit they probably can't understand it if they tried, because Regan is only an IM.*
      *It basically means that only Magnus and Hikaru get to decide who cheats and who doesn't. And we don't even get to question them.*

  • @jordankeller2075
    @jordankeller2075 PÅ™ed rokem +657

    Mad respect to Magnus’ coach, there is a lot of pressure to give even the tiniest hint, but instead of trying to word things in a clever way he took the direct route and was not afraid to stand on his morals.

    • @mohitoness
      @mohitoness PÅ™ed rokem +28

      Saying Magnus wasn’t surprised while not saying why is not taking any direct route lol

    • @seanplayscl
      @seanplayscl PÅ™ed rokem +53

      @@mohitoness I think by "direct route" they mean how he was like "I'm not gonna tell you anything of worth" instead of pretending to give an answer

    • @ekki1993
      @ekki1993 PÅ™ed rokem +1

      I mean, he still worded things in a clever way. He just clarified he wouldn't give information beforehand.

    • @alexwoodies4043
      @alexwoodies4043 PÅ™ed rokem +1

      Lol why even do the interview then?

    • @michaelbortolin5888
      @michaelbortolin5888 PÅ™ed rokem +8

      Uhh hes not not standing on his morals, hes standing on his job security

  • @fanrco766
    @fanrco766 PÅ™ed rokem +103

    if you listen to every 7th word he says, theres a coded message for Hans about what openings magnus will play in the next tournament.

    • @playtoearnmeta
      @playtoearnmeta PÅ™ed rokem +3

      Looks like we found the mole

    • @JOBXR
      @JOBXR PÅ™ed rokem +14

      You’re looking to far into it… the real message is on his shirt he’s leaking the opening lol

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +2

      I wish people would stop acting like it's not possible that Hans cheated. Like I genuinely don't think that he did, but it wouldn't help my point to say that he couldn't have, because then I'd just be wrong.

  • @han-huo
    @han-huo PÅ™ed rokem +376

    Carlsen's coach: *Says literally anything*
    Hikaru: *Starts laughing hysterically*
    FUCK I GOT A HEART FROM HIKARU BUT EDITING REMOVED THE HEART

    • @w.s6124
      @w.s6124 PÅ™ed rokem +8

      To be fair its quite funny

    • @MrJoosebawkz
      @MrJoosebawkz PÅ™ed rokem +15

      its his editor that hearts

    • @han-huo
      @han-huo PÅ™ed rokem +6

      @@MrJoosebawkz Still was a cool

    • @meatslicer458
      @meatslicer458 PÅ™ed rokem +2

      Gg no re

    • @legueu
      @legueu PÅ™ed rokem +8

      Edit also remove pins btw.

  • @brianbernstein3826
    @brianbernstein3826 PÅ™ed rokem +244

    “Chess requires entire brain, no room left other things. Maybe alcohol.†Peter Nielsen, 2022

    • @Rob-sf4xy
      @Rob-sf4xy PÅ™ed rokem +19

      This quote belongs in a agadmator video

    • @AbhishekKumar-uu4uj
      @AbhishekKumar-uu4uj PÅ™ed rokem +1

      At what point ?

    • @jackasome58
      @jackasome58 PÅ™ed rokem

      Maybe a bong ripe, everyone has their own sauce I suppose.

  • @skeptic9991
    @skeptic9991 PÅ™ed rokem +11

    Peter proved to be a very smart an intellectually honest person. The fact that he acknowledges that he doesn't have technical acumen to discuss certain topics is actually admirable and is something EVERYONE should do. People that use internet to cast their opinions on topics they know nothing about should take a page out of his book.

  • @jonathanbaxter5821
    @jonathanbaxter5821 PÅ™ed rokem +9

    The main thing about Regan is he uses a statistical approach that can't detect infrequent cheating.

  • @EnginAtik
    @EnginAtik PÅ™ed rokem +61

    Hikaru is the gateway drug to Chess for us noobs.

  • @tone21
    @tone21 PÅ™ed rokem +157

    Magnus’ coach should take up stand up comedy the way Hikaru is laughing his ass off every couple minutes.

    • @dannygjk
      @dannygjk PÅ™ed rokem

      😂

    • @charlespanache7047
      @charlespanache7047 PÅ™ed rokem

      Bc all he's doing is dodging questions. Basically wasting everybody's time.
      Dude should run for office he can talk for 15minutes and answer nothing. Listen to how he answers his 1st question.
      - neutral response.
      - magnus employs me.
      Basically dude is just a weak PR mouth piece.

    • @retromunkey
      @retromunkey PÅ™ed rokem +5

      @@charlespanache7047 he's doing his job then...
      He isn't going to throw his employer/friend under the bus is he?

  • @rileyprice8557
    @rileyprice8557 PÅ™ed rokem +85

    "most chess grandmasters barely have education because we actually have to care about chess" is the most true statement I think I've ever heard.

    • @drugaddict931
      @drugaddict931 PÅ™ed rokem +3

      False. How many grandmasters actually end up being able to support themselves from just chess alone? Most of them need another job, which will require them to have an education

    • @xDread
      @xDread PÅ™ed rokem +7

      @@drugaddict931 Oh? That is actually shocking to hear. My country doesn't have that requirement. Here in the USA, businesses get to choose who they hire on their own terms - they are not required to hire an educated workforce. As an uneducated individual, you can walk into an unemployment office, and get a job the same week without requiring any education. Whereabouts in the world do you live? I'm interested in your culture.

    • @tomatoisnotafruit5670
      @tomatoisnotafruit5670 PÅ™ed rokem +3

      @@drugaddict931 you don't need an education to get a job

    • @batteo3318
      @batteo3318 PÅ™ed rokem +2

      @@tomatoisnotafruit5670 it depends of where you live. Here in Italy you absolutly do.

    • @henrymccoy2306
      @henrymccoy2306 PÅ™ed rokem +3

      @@batteo3318 no you don’t lmao. There is nowhere in the world where you can’t get at least a job as a labourer without an education. Too much of every country’s workforce has no education for them to be able to afford denying them a job

  • @ricky4673
    @ricky4673 PÅ™ed rokem +101

    I love this guy, he doesn't evade qu3stions he just says he wouldn't tell you. I would love for him to be a politician. They won't be honest that they can't tell you. This dude is cool.

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +3

      If you love this guy for not answering questions then wtf is your problem with Magnus?

    • @ricky4673
      @ricky4673 PÅ™ed rokem +28

      @@forcommentingpurposesonly2918 When did I say I have a problem with magnus?

    • @roachji6422
      @roachji6422 PÅ™ed rokem +3

      His wife is a politician :-)

    • @TheBomber15
      @TheBomber15 PÅ™ed rokem +3

      @@forcommentingpurposesonly2918 If someone were to have a problem with Magnus, it would be because he has started with the insinuation of allegations without backing it up, providing evidence, or even personal context on the matter. Instead dragging it this out, wrongly or rightly discrediting an individual’s victory over him, and causing some likely mental turmoil.
      But yeah, I don’t see how what Magnus could be doing wrong.

  • @TuxedoMedia
    @TuxedoMedia PÅ™ed rokem +99

    Needs a control group tournament. Have tournament where a known group cheats but the organizers don't know who or how many. Then see how effective they are at catching them.

    • @joshh9542
      @joshh9542 PÅ™ed rokem +8

      The organizers will take more strict anti-cheating measures in a tournament where they absolutely know players are cheating than a regular tournament

    • @georgeklimov3464
      @georgeklimov3464 PÅ™ed rokem +21

      @@joshh9542 I think you don't get what he's saying. Instead of going for a fair tournament, go for an unfair tournament and see how good the organizers are at catching cheaters. It's a great idea tbh.

    • @zacharybarrett6784
      @zacharybarrett6784 PÅ™ed rokem +3

      You'd have to silo the anti cheating team otherwise the various methods would be leaked. And players would have tells. It'd have to be based on the moves alone. And the tournament would have to be large enough, and maybe with the cheaters changing every round, with slightly different cheating tactics. You'd also have to silo the team coordinating the cheating. Some parties have more to lose based on the results. So you could get some leaking and spying.

    • @pfeilspitze
      @pfeilspitze PÅ™ed rokem +9

      @@joshh9542 Sure, but it'd still be interesting to know if they'd accuse the right people, if they'd catch everyone, if they'd accuse some non-cheaters, etc.

    • @smolytchannel5062
      @smolytchannel5062 PÅ™ed rokem +2

      You think Ken Regan hasn't already thought of that? He did create some some simulated tournaments using simulated chess players who play simulated moves, and found out that his simulations were accurate to real life

  • @sub-harmonik
    @sub-harmonik PÅ™ed rokem +82

    magnus' staff speaks for itself

    • @dannygjk
      @dannygjk PÅ™ed rokem

      By "staff" do you mean the people who work for him? 😉

    • @charlespanache7047
      @charlespanache7047 PÅ™ed rokem

      Yea MC made false accusations and his lap dog has a hard time justifying MC actions.

  • @hoanganh9653
    @hoanganh9653 PÅ™ed rokem +440

    I'm surprised how Hikaru is always able to squeeze a big laugh out of absolutely nothing

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +30

      I'm surprised how you're always able to squeeze needless, non-constructive criticism out of absolutely everything that happens on this channel just for the fucking sake of it. If you didn't find it funny, don't laugh. Don't tell other people not to laugh. "I don't like chocolate, so you'd better never chocolate ever again, asshole". "I've decided that I'm against breathing, so you all better stop fucking breathing".

    • @captain_britain
      @captain_britain PÅ™ed rokem +90

      ​@@forcommentingpurposesonly2918 ...Was OP's comment even negative? I'm also surprised how easily Hikaru laughs, but I enjoy it and it makes me laugh too.

    • @Kevinmalonenotpost
      @Kevinmalonenotpost PÅ™ed rokem +54

      @@forcommentingpurposesonly2918 ur parents didn’t hug you enough

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +5

      @@captain_britain maybe. if so, my b.

    • @terminallydrunk1900
      @terminallydrunk1900 PÅ™ed rokem +3

      @@forcommentingpurposesonly2918 lol

  • @hi-ve1cw
    @hi-ve1cw PÅ™ed rokem +45

    What Peter means when he said chess GMs barely have an education is that most of them never went to university, as they didn't have time and just focused on their chess career. There are of course many GMs who did go to university, but in general most didn't go

    • @JohnVC
      @JohnVC PÅ™ed rokem +9

      I agree with him. I think most top grandmasters now don't even have a basic level of liberal arts education, as far as an undergraduate degree would go. I think it's also possible that top masters aren't educated/don't care about such things as current affairs, politics, business, societal issues, etc. There are exceptions of course, but I have yet to see a grandmaster, besides maybe Kasparov, talk about something serious besides chess.

    • @da96103
      @da96103 PÅ™ed rokem +2

      @@JohnVC Karjakin: I want to talk about something serious.
      Karjakin banned for 6 months.

    • @JohnVC
      @JohnVC PÅ™ed rokem +8

      @@da96103 It's not so much what he talked about, but how he talked about it. Another example of a politically and socially inept grandmaster that was only groomed to play chess.

    • @da96103
      @da96103 PÅ™ed rokem

      @@JohnVC You got a point there.

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +7

      I think he's right, I think most GMs have a very poor level of education, probably not attending or not focusing on university, and generally caring more about their hobbies than anything else in life. So yeah, the average American citizen.

  • @smartfck4
    @smartfck4 PÅ™ed rokem +19

    If you play it backwards at 0.5x speed it actually gives Magnus preparation for next round

  • @Hidegety1
    @Hidegety1 PÅ™ed rokem +9

    He was as open and truthful as he could. Misa liked him.

  • @PhO3NiX96
    @PhO3NiX96 PÅ™ed rokem +29

    It was a "I can neither confirm nor deny details of any operation without the secretary's approval" moment LOL

  • @heatpete5106
    @heatpete5106 PÅ™ed rokem +22

    You know Hikaru means business when he is wearing the pineapple shirt

  • @django-unchained
    @django-unchained PÅ™ed rokem +5

    So Magnus the Child can't even publicly speak about this, he has to have his "parents" talking for him. All respect is lost now for Magnus who is a falling star and struggle mentally to handle it. Which is not sportsmanship or mature behavior.

    • @giriprasadkotte9876
      @giriprasadkotte9876 PÅ™ed rokem +1

      Magnus must be crying himself to sleep 😭

    • @LegendLength
      @LegendLength PÅ™ed rokem

      The fans are enabling his mental breakdown ironically, they aren't giving him the chance to admit he fucked up

  • @robertalexstorm
    @robertalexstorm PÅ™ed rokem +30

    As a film writer, I can see this story becoming a movie one day.

    • @eldadenobhayisobo6300
      @eldadenobhayisobo6300 PÅ™ed rokem +1

      I usually imagine that too.Can't wait for it.Lolz

    • @oscaroscar7904
      @oscaroscar7904 PÅ™ed rokem

      It would be epic if magnus was able to beat the computer( if he cheated that is) so he just walks away winning against someone who cheated but still lost lol

  • @Narrator007
    @Narrator007 PÅ™ed rokem +20

    Trying to get information out of Magnus's coach is like trying to squeeze orange juice out of a banana.

  • @cous
    @cous PÅ™ed rokem +223

    This drama is actually great for chess and it’s popularity. Gets people talking and interested

    • @chottomatekudasai-kun3887
      @chottomatekudasai-kun3887 PÅ™ed rokem +33

      Sadly, for the wrong reasons tho

    • @oriondx72
      @oriondx72 PÅ™ed rokem +2

      keeps it up he's gonna piss more people off.

    • @kenm5159
      @kenm5159 PÅ™ed rokem +10

      You'll realize within 6 months that your statement is wrong. Lots of people are going to leave chess because of this, especially those who have started within the last year.

    • @cous
      @cous PÅ™ed rokem +2

      Chess is not going to make the news because of good chess games. Cheating might sound bad, but there’s much worse ways chess could get attention, e.g. super GM commits violent crime against opponent, Norway declares war on USA etc.

    • @kenm5159
      @kenm5159 PÅ™ed rokem +2

      ​@@cous You don't need to believe me, just wait. The game is going to get hit with a big loss of viewership and players
      The influx of attention is just that, only attention. As far as people wanting to play, learn, and watch will drop significantly.
      Disgusting how all of your representatives have allowed one player disrespect the entire sport and let him get away with all these childish actions. If one loves the game and all those who play it, you approach it in a correct manner, not in this way of throwing all caution to the wind plus knowing that there is no one who will criticize or condemn you. I can't imagine the biggest sports figures doing this in any of their respective sports because of course there would be consequences. This child is a god to your small game of chess.
      again, don't believe me. just watch.

  • @OrigamiRadio
    @OrigamiRadio PÅ™ed rokem +8

    That was one of the best interviews I've ever seen 😂

  • @joba6794
    @joba6794 PÅ™ed rokem +4

    I hope they would be more strict in their anti cheating measures, knowing that some players have cheated before and cheating has become very easy online.

  • @danny_4498
    @danny_4498 PÅ™ed rokem +6

    He confirmed that Magnus is gonna speak on the situation

  • @Irdanwen
    @Irdanwen PÅ™ed rokem

    With your comment at around 8:50 explaining what the coach said in plain English now I'm glad I am subscribed to this channel.

  • @zeus1141
    @zeus1141 PÅ™ed rokem +4

    It seems to me that a machine like the airport one where they check all the way to the core of your being should fix these type of allegations rather quick and I'm surprised they only use a wand to check the players in this day and age.

  • @MichaelDavis-zf6nt
    @MichaelDavis-zf6nt PÅ™ed rokem +5

    They are just going to have to get airport security screening equipment for over the board play. Maybe just play in a large Faraday cage, with the camera/mic being the only electronic lines going in.

    • @abeoist
      @abeoist PÅ™ed rokem

      That doesn't stop another person from having a device and just communicating the moves to the cheater

  • @basicallyeveryone
    @basicallyeveryone PÅ™ed rokem +4

    Is it just me, or does Margnus' coach look and feel like the older lumberjack version of Magnus?
    Imagine him in a flannel shirt...
    They even have the same inflection in their voice

  • @andrewolivetreemixing
    @andrewolivetreemixing PÅ™ed rokem +4

    Danya had a good explanation on the blind spot of that statistician

  • @thesphyrth
    @thesphyrth PÅ™ed rokem +37

    What I got from this:
    "I have my takes, but Magnus should speak for himself."

  • @perryjames9139
    @perryjames9139 PÅ™ed rokem +3

    This is loyalty. My man. GG.

  • @mohamedkhattab4439
    @mohamedkhattab4439 PÅ™ed rokem +8

    Was here when it was Magnum carlos

  • @Chris.M
    @Chris.M PÅ™ed rokem +2

    Great interview ðŸ‘

  • @elmargico9858
    @elmargico9858 PÅ™ed rokem +1

    Oh man...it was so funny when Hikaru had to.laugh about he was saying at the beginning👌 This guy, this accent, this talking🤣🤣🤣

  • @niallycyrus4476
    @niallycyrus4476 PÅ™ed rokem +3

    I’ve never seen someone say so much yet so little all at the same time! Brilliant ðŸ‘ðŸ»ðŸ‘ðŸ»

  • @Allenar4
    @Allenar4 PÅ™ed rokem +36

    I really really like this guy. Not surprised at all that magnus and him have worked together for so long

  • @marcusstokes5923
    @marcusstokes5923 PÅ™ed rokem +1

    I think it was a language barrier thing for when he said chess players aren’t “educated†I think he was just saying educated (not an expert) as in not educated in the computer science side of seeing if someone cheated or not

  • @Yurg99
    @Yurg99 PÅ™ed rokem +62

    I’ve never watched chess in my life but I’m invested. This is better than rings of power. Yes the bar is that low for entertainment these days

    • @Fred-tz7hs
      @Fred-tz7hs PÅ™ed rokem +10

      no it's not. go outside, touch grass

    • @moriartythethird5709
      @moriartythethird5709 PÅ™ed rokem +3

      Haha that's where I'm at.

    • @edwardp7725
      @edwardp7725 PÅ™ed rokem +6

      Rings of Power is just a generic fantasy show, I don't even consider it LoTR. 1 bn well spent LMAO

    • @TheZorak420
      @TheZorak420 PÅ™ed rokem +3

      @@Fred-tz7hs I'm a landscaper/gardener and I can confirm that rings of power is a mediocre show and that the bar is that low indeed!

    • @morelhunter3966
      @morelhunter3966 PÅ™ed rokem +1

      ​@@Fred-tz7hs Are you mansplaining?

  • @rosniper343
    @rosniper343 PÅ™ed rokem +8

    Got to love the guy’s honesty 😇ðŸ‘ðŸ»ðŸ˜Ž

  • @themarushin
    @themarushin PÅ™ed rokem +4

    1 or 2 "cheat" moves in a critical moment on a board could win a match in gm level... how can you proove that?

  • @ChessUSee
    @ChessUSee PÅ™ed rokem +2

    About time for an explanation!

  • @salamashiru6153
    @salamashiru6153 PÅ™ed rokem +52

    Magnus has the same cadence as his coach.

    • @joseraulcapablanca8564
      @joseraulcapablanca8564 PÅ™ed rokem +15

      This is because he is Danish, and the English cadence of Scandinavians is very similar, due to the difference in speech stress patterns.

    • @NJ-wb1cz
      @NJ-wb1cz PÅ™ed rokem

      This means that Magnus cheats, apparently

  • @f4k4
    @f4k4 PÅ™ed rokem +17

    Hikaru’s laugh speaks for itself

  • @bunhead8
    @bunhead8 PÅ™ed rokem +37

    from this short interview I would guess that Peter Nielsen is an extremely likeable, intelligent and sensitive person. Obviously he cannot comment on what everyone wants him to, but his general comments about the state of chess are correct and heartfelt. Bridge players are also going through this as several at the world championship level have been caught cheating in the past few years - badly tainting the professional game in the same manner.

    • @LegendLength
      @LegendLength PÅ™ed rokem +1

      "several at the world championship level have been caught cheating"
      Who got caught cheating in chess?

    • @ugaugalandia
      @ugaugalandia PÅ™ed rokem +10

      @@LegendLength re-read and correct accordingly, please.

    • @IrohsTeaShop
      @IrohsTeaShop PÅ™ed rokem

      @@ugaugalandia Ugh

    • @bunhead8
      @bunhead8 PÅ™ed rokem

      @@LegendLength I meant bridge players that have been caught cheating.

  • @SharptonsRaceCard
    @SharptonsRaceCard PÅ™ed rokem +1

    @3:50 I think this is what Levy Rozman calls "danger levels"

  • @quasiZote
    @quasiZote PÅ™ed rokem +2

    - "Are you suspecting Hans Niemann of cheating?"
    - "...it doesn't look like fella was cheating at the chess Olympiad which he obviously was and was caught..."
    he doesn't even need to answer properly because the *facts speak for themselfs*

  • @mikem668
    @mikem668 PÅ™ed rokem +5

    Chess and Go are very different games. But after AlphaGo, young Go players immersed themselves in engine play. Watching some of the games, commentators were amazed at how often they played the best moves. Seemingly more than the older players. AFAIK Go theory has been revolutionized in a way chess has not. I'm a mediocre Go player, but my sense is that many engine moves in Go are way more incomprehensible than engine moves in chess. In effect the engines are wiring the brains differently.

    • @NJ-wb1cz
      @NJ-wb1cz PÅ™ed rokem

      One word - butt plug go computers

    • @williamhu9567
      @williamhu9567 PÅ™ed rokem

      @@NJ-wb1cz noooooo not this again

  • @Stn-qx6kl
    @Stn-qx6kl PÅ™ed rokem +5

    What did you guys expect him to say? this guy at least respects privacy

  • @TruthAndReconciliation
    @TruthAndReconciliation PÅ™ed rokem +2

    Great video, anyone know how to mute the annoying guy at the bottom right that keeps pausing?

  • @HurryTheJug
    @HurryTheJug PÅ™ed rokem

    Props for host Kaja Snare for asking direct questions!

  • @rachelreed4515
    @rachelreed4515 PÅ™ed rokem +14

    I need this guy as my lawyer

  • @LordHugo1982
    @LordHugo1982 PÅ™ed rokem +3

    I work with statistics daily. I haven't read the entire methodology on how Regan actually tested that. However, Regan´s chess level is not a factor because the moves are compared regarding the "best" engine move and not his personal evaluation. What I think is missing in Regan's analyses, or more than missing, something to take into account, is that, on average, the errors of Hans are not significantly less or more than his competition. In addition, his performance is within the expected, taking into account variability. However, from what I saw, if, for example, Hans cheats in 2 moves within 2 games in a tournament with 12 games, then those "super" moves will be hidden within the "averages" (not even taking into account that maybe were not moves, but tactical considerations). To put it simply, if you average the entire height of university students in the USA, you might say they have similar size, but you are missing the 3 almost 8-foot people that study only in one. That's the problem of averages and the problem of Regan analyses in considering 2 years. As we know, you would not have to cheat in every move, just in the 3 most important of the tournament. Just an idea that someone can overlook can be enough, and it will not be caught by averages, or most likely not... at least to my knowledge of what Regan has shown. Maybe if he did an actual scientific article on the method, it would be easier to check.

    • @LegendLength
      @LegendLength PÅ™ed rokem

      He can analyze it all day but until there's actual evidence rather than conjecture ...

  • @poochpoints
    @poochpoints PÅ™ed rokem +1

    Quick Hikaru, what is the quadratic formula?

  • @miguelfonseca1112
    @miguelfonseca1112 PÅ™ed rokem +1

    Hikaru, you should get David Smerdon to chime in on this cheating statistics+chess issue. David is a GM and he has a PhD in Economics. Empirical economics uses very sophisticated statistical methods.

  • @TheRMMFilms
    @TheRMMFilms PÅ™ed rokem +6

    Danya in the top 1% most educated chess players with his Stanford degree.

  • @sla7889
    @sla7889 PÅ™ed rokem +41

    The coach speaks for himself

  • @Grandcapi
    @Grandcapi PÅ™ed rokem +2

    Chess&Tech channel interviewed Regan. Very long interview and those interested or experts in math and statistics may like it.

  • @ryanslade2282
    @ryanslade2282 PÅ™ed rokem

    I was surprised to hear Hikaru mention my college when he mentioned UB

  • @aadika45
    @aadika45 PÅ™ed rokem +23

    I agree. One model of statistics doesn't cover all aspects of chess. We also don't know the accuracy of the model in term of how it predict cheating. At the highest level, the super-GM level need one move/idea from the engine to give significant result for the game. People at lower level need assisted from computer in every move to win the game, but the super grandmaster only needs one move/idea (at the critical situation) from the engine to give a significant result.
    I also believe that the model cant gives great accuracy in the highest critical situation. Let's say, Ding, uses two or three engine moves/ideas against Ian, for the shake of testing how accurate the model produces. I am pretty sure that the model will say Ding is not cheating.

    • @Fred-tz7hs
      @Fred-tz7hs PÅ™ed rokem

      can you speak english?

    • @aadika45
      @aadika45 PÅ™ed rokem +1

      ​@@Fred-tz7hs thanks for reminding. The sentences are now corrected.

    • @cyberdron
      @cyberdron PÅ™ed rokem +5

      Well, I think in that case you simply can not detect cheaters (this kind of cheaters I mean). It is just impossible, I think for obvious reasons. What can be done is the most strict checking for any devices before games plus 15 min delay in translations. And of course let the statisctics do it's work as long as it can. Also, the last but not the least, more serious punishment for cheaters, maybe even no second chance in case of OTB cheating (ban for life in all official tournaments). IMO it is the best way to deal with this problem

    • @vanillaghetto
      @vanillaghetto PÅ™ed rokem +1

      Actually, before you assume things, you should watch the interview with Dr. Regan on the tournament broadcast with Kaja yesterday. He has implemented exactly what you "believe the model can't" (your second paragraph).

    • @aadika45
      @aadika45 PÅ™ed rokem +1

      @@vanillaghetto Well. Who were the 2800 rated players that are to be the test train of the model? No one, right?

  • @timanderson6005
    @timanderson6005 PÅ™ed rokem +4

    I prepared for 15 different openings against Vassily Ivanchuk. Vassily played the 16th......
    Thats why Ivanchuk is a legend.

  • @ahmadabada5130
    @ahmadabada5130 PÅ™ed rokem +3

    Very good discussion and analysis

  • @nametry3
    @nametry3 PÅ™ed rokem +2

    To be fair, being smart and being educated are two different things. Man's got a point

  • @86joncooper
    @86joncooper PÅ™ed rokem +14

    This guy should be a lawyer, he implies but doesn’t get caught up in blunt answers

  • @jamesatkins7592
    @jamesatkins7592 PÅ™ed rokem +3

    Daymm he's such a stand up guy

  • @DavidBadilloMusic
    @DavidBadilloMusic PÅ™ed rokem

    Judit Polgar played in that tournament in Argentina in 2005, if I remember correctly.

  • @TVSuchty
    @TVSuchty PÅ™ed rokem +1

    I am a 1600 player on a good day, a friend of mine is 1900 (IM too SuperGM)
    I feel like my friend is viewing a different board sometimes.
    My trainer is a GM, his understanding is so far from mine that he just cannot understand how one can be 1600.

  • @ayush11222
    @ayush11222 PÅ™ed rokem +3

    Correction In Video Tittle: Magnus Carlsen's Coach DID NOT Speak Up on Cheating Drama

  • @Lyrics4y0u
    @Lyrics4y0u PÅ™ed rokem +6

    "how does magnus feel abou..."
    "im sorry but as magnus coach, i must pretend, who is magnus?"

  • @exalt9411
    @exalt9411 PÅ™ed rokem +1

    I can’t believe he would say that

  • @Seaileanu
    @Seaileanu PÅ™ed rokem +1

    Hikaru, would you review the game today between Magnus and Ivanchuk?

  • @elvismorellidigitalvisuala6211

    Maybe Fischer Random is the only future of the chess, the only way to see who is the strongest... Opening, computers... Fischer was right this destroy chess.

  • @kmktruthserum9328
    @kmktruthserum9328 PÅ™ed rokem +4

    Here before they change the name from magnu to Magnus

  • @julianhodgson1961
    @julianhodgson1961 PÅ™ed rokem +1

    Hikaru- Ken Regan is not a strong enough chess player - I still haven’t forgotten how he beat me in the early 80’s in Ramsgate in the last round stopping me from getting my final IM norm - good times lol 😭😭😭

  • @sluggy6074
    @sluggy6074 PÅ™ed rokem +2

    What he said about education isn't wrong. Max Euwe and Paul Morphy two incredibly well educated individuals both expressed the difficulty of balancing the study of higher education and chess. He's of course not referring to intelligence. Also a grandmasters idea of education is likely a lot higher than other peoples idea of what makes someone educated

  • @scagish
    @scagish PÅ™ed rokem +7

    This man just said nothing with a huge amount of words. My respects ROFLMAO

  • @user-op6rh4mp9b
    @user-op6rh4mp9b PÅ™ed rokem +3

    Magnus's coach looks like an older version of Magnus

  • @noahpalmer6653
    @noahpalmer6653 PÅ™ed rokem

    One of the greatest interviews I've seen

  • @pfeilspitze
    @pfeilspitze PÅ™ed rokem

    "I'm not really going to tell you anything there." (1:01) Beautiful.

  • @sergi23
    @sergi23 PÅ™ed rokem +49

    Hikaru, when Peter says GMs don't understand the master-level statistics of Ken Regan because they had no education because they had to worry only about chess, I think he's really saying just the opposite about Regan: he has no knowledge of chess because he has had to worry about statistics.

    • @yogi30303
      @yogi30303 PÅ™ed rokem +4

      That's exactly what Hikaru said smh

    • @tootoomcgoo9674
      @tootoomcgoo9674 PÅ™ed rokem +7

      I mean, Ken Regan was a junior level IM. He was extremely talented at chess. He's not some random math-statistics dude who wandered into an unknown domain. He's probably one of the best suited people on the planet to apply statistics to chess in the interest of spotting cheating / anomalous behavior.

    • @MattMacKinnon
      @MattMacKinnon PÅ™ed rokem +1

      @@tootoomcgoo9674 True, but the difference in skill between him and a 2700 is about the same as the difference in skill between him and the average tournament player.

  • @conspicuousconsumer7160
    @conspicuousconsumer7160 PÅ™ed rokem +98

    No further statement required...Magnus' chess speaks for itself.
    In all seriousness, when someone like MC commits his life's focus for so long and at such a high level it becomes second nature being able to identify and anticipate descision patterns and reactionary behaviors.
    for what it's worth:
    IMO if he sensed patterns and reactions that led him to believe something was fishy, then I would trust his expertise (even over any computer analysis). MC's 'hunch', however, isn't 'proof' so what can he really do other than refuse to ever play that opponent again...certainly not via computer, and probably not OTB (even with stringent security measures in place).
    way ahead:
    I would leave everyone involved in this alone, and go back to business as usual. Let EVERYONE'S chess speak for itself. If those two never play eachother again, then so be it. The chess must go on.

    • @pavliv
      @pavliv PÅ™ed rokem +13

      You truly have spoken for yourself.

    • @efthymiosn3381
      @efthymiosn3381 PÅ™ed rokem +4

      Hans is a wierd mind and player. Probably confused him.

    • @iD-du1iu
      @iD-du1iu PÅ™ed rokem +8

      If you have the guts to speak about someone at least prove your words. That’s the problem that I see here

    • @sirphantoon6731
      @sirphantoon6731 PÅ™ed rokem +7

      @@iD-du1iu that's exactly what's so cringe about this whole "debate". He doesn't "speak", he is not responsible to prove anything even though everyone thinks that... leave the guy alone and don't transform your emotional reaction into a responsibility of someone else

    • @dimitralex1892
      @dimitralex1892 PÅ™ed rokem +1

      is 'leaving him alone' really a good option? i mean look at the tournaments... is it fair that hans gets a 'free' win? no, it is not. magnus is brings chaos... and how do you think future tournaments will be? if magnus keeps up his resignations you can simple not invite him to tournaments anymore when hans is in the tournament as well... and that is just sad and stupid... the way magnus is handling this is completely against fair sportsmanship... and yes, i get his point. and he is making a strong point, but 'back to business as usual' is just not possible...

  • @MattSmith-il4tc
    @MattSmith-il4tc PÅ™ed rokem +1

    Nielsen looks exactly like Roy (Pam's original boyfriend) from The Office...

  • @catcatcatcatcatcatcatcatcatca

    It’s important to distinguish between trust in there not being any cheating and trust in measures to catch and discourage cheating. There will never be confidence in detecting cheating as in ruling out the possibility of cheating entirely. The discussion should always be on confidence in measures taken and what they rule out, as well as what they could plausibly fail to detect that is known as a vector for cheating.
    Seriously, it is very easy to adopt a witch hunt mentality. If poor anti-cheat measurements alone is enough to make one player seem suspicious, all players should be treated as suspicious in similar manner. Meaning the solution is improving the system and waiting for more data - not jumping into conclusions.
    Absence of evidence is not evidence of absence, but there are very good reasons we dedine innocence through lack of evidence, instead of evidence of absence. There is no evidence of absence. That simply doesn’t exists.

    • @philipstevenson5166
      @philipstevenson5166 PÅ™ed rokem

      legal evidence is not how we behave, and with fair reason as it is at least half designed to defend power. gmhikaru talks about legal threats, which recalls lance armstrong. if niemann is honest he should be volunteering to validate his rating in a controlled match versus a 2700-set computer.

    • @joaocarlosdarosafagundes7482
      @joaocarlosdarosafagundes7482 PÅ™ed rokem

      You can prove a negative statement by proving a positive statement which contradicts directly that which you want to negate. For instance, you can't prove directly I wasn't in Japan yesterday, yet you can prove I was in Brazil, which is contradictory to being in Japan, because I can't be in both countries at the same time, then proving the negative proposition that I wasn't there. It's a _reductio ad absurdum,_ I believe. You can also have mathematical proofs by this method, as the proof that the square root of 2 is irrational.
      Plus, this Sagan's quote really doesn't seem to be very good to me. Some evidences are expected for some propositions. If these expected evidences don't exist, this absence of evidence is an evidence of absence. For instance, if I were the king of United States it would be expected to exist things relating me to this high charge. If there's nothing, it seems I'm not. The right thing to say is probably "absence of evidence is not prove of absence", or "not all absence of evidence is evidence of absence", because some evidences are really not expected, even if something is true.
      My response has nothing to do with this specific case, though.

  • @biffboffo
    @biffboffo PÅ™ed rokem +6

    Is an IM like a basic professional athlete, a GM like an All-Star athlete, and a Super GM like a Hall of Fame level athlete?

    • @thelonewolfie34
      @thelonewolfie34 PÅ™ed rokem +6

      IM = minor league player, GM= pro player, Super GM= allstar Candidates = hall of fame level

    • @biffboffo
      @biffboffo PÅ™ed rokem +2

      @@thelonewolfie34 That's what I was wondering, if the gap between IM and GM was that great. Thanks!

    • @joaocarlosdarosafagundes7482
      @joaocarlosdarosafagundes7482 PÅ™ed rokem +1

      I've made a response filled with numbers I had calculated by myself, but it doesn't appear to me anymore. To summarize and focus more specifically on your question: it seems if you sum up the number of all IMs and GMs, the GMs will be around the 70th percentile - i.e., will correspond to 30% of these. Not too big a difference.

    • @joaocarlosdarosafagundes7482
      @joaocarlosdarosafagundes7482 PÅ™ed rokem

      The other numbers I had came with: 19,518 titled players, 4,013 IMs (20.5% of those titled players, [edit: 70.5th percentile, I suppose]), 1,773 GMs (91st percentile), and 41 Super GMs (99.98th percentile). Those are a bit old, but they are the data I have to work with. Obviously, not all chess players are titled, only some of the strongest - but not also all the strongest, because not every good chess player take part on official tournaments.

    • @joaocarlosdarosafagundes7482
      @joaocarlosdarosafagundes7482 PÅ™ed rokem

      Has my original response been erased because of a typo related to the initials of Fide Master? I don't know.

  • @bishoptakesknight
    @bishoptakesknight PÅ™ed rokem +5

    Thats so true about education and chess masters. Id like to see what Hikaru knows about anything outside of Chess. It would be interesting.

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem +2

      Ah I see, so instead of asking him about the thing he's studied and worked on improving his entire life, you think it would be funny to ask him about something completely random. What do you have a degree in then, if any, because whatever that is, how about instead of that, I ask you about something entirely unrelated and then laugh at you when you can't tell me the answer.

    • @ekki1993
      @ekki1993 PÅ™ed rokem

      @@forcommentingpurposesonly2918 Top level chess takes a degree of dedication that's hardly comparable to any career. That's both speaking nicely of how dedicated chess masters are at their craft while reminding that they sacrificed a lot for it. Being ignorant isn't always a scathing remark. Sometimes it's just a limitation that should be taken seriously.

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem

      @@ekki1993 "Being ignorant isn't always a scathing remark." Make this sentence make sense please. Being ignorant is a property, not a remark, so I would like you to clarify what the fuck it is that this is meant to mean.

    • @ekki1993
      @ekki1993 PÅ™ed rokem

      @@forcommentingpurposesonly2918 Works for being called ignorant if you feel it's more consistent that way. Does it really make the rest of the point not clear or are you being dense for the sake of it?

    • @forcommentingpurposesonly2918
      @forcommentingpurposesonly2918 PÅ™ed rokem

      @@ekki1993 Thank you for clarifying, however I do feel as though this statement contradicts your op, unless said op was not written with negative intent, in which case I must apologize for my overreaction, I'm used to dealing with assholes in these comment sections.

  • @eraycayir7667
    @eraycayir7667 PÅ™ed rokem

    where can I watch these Chess big Tournaments ?

  • @ColdColdColdGround
    @ColdColdColdGround PÅ™ed rokem +1

    That hikaru laugh is golden

  • @zerseus9158
    @zerseus9158 PÅ™ed rokem +4

    why does his coach look like a relative of magnus

  • @johnpetkos5686
    @johnpetkos5686 PÅ™ed rokem +6

    He was Viswanathand Anand's coach?? That guy looks 20 years younger than Anand 🤣🤣🤣🤣🤣

    • @writamchatterjee4676
      @writamchatterjee4676 PÅ™ed rokem

      And it's true dude

    • @kieran1990able
      @kieran1990able PÅ™ed rokem +6

      Coach doesn't just mean he teaches them. It's more of side assistant, GM will ask him to analyse the moves, look for openings, tactics, basically find lines that GM can memorise and use it in championship match.

    • @humanbean3
      @humanbean3 PÅ™ed rokem

      @@kieran1990able yeah i think i saw a video of carlen's "camp" or something, and there was a young dude still in his teens in appearance helping out.

    • @joaocarlosdarosafagundes7482
      @joaocarlosdarosafagundes7482 PÅ™ed rokem

      @@humanbean3 Are you talking about Dubov? If you're, he's currently the 40th most rated player in the world, and was 25 years old during the last World Championship.

    • @joaocarlosdarosafagundes7482
      @joaocarlosdarosafagundes7482 PÅ™ed rokem

      According to Wikipedia, Nielsen is 3 years younger than Anand.

  • @theantinatalismzone3982
    @theantinatalismzone3982 PÅ™ed rokem +1

    I once played blitz with Peter Heine Nielsen and then I have no recollection what happened

  • @CaradhrasAiguo49
    @CaradhrasAiguo49 PÅ™ed rokem

    6:11 for HIkaru reaction to PH Nielsen's "GMs barely have education" quote