Bumblebee - How Character Killed A Movie | Anatomy Of A Failure

Sdílet
Vložit
  • čas přidán 28. 03. 2019
  • Bumblebee is the first Transformers film where the studio seemed to genuinely care about the characters. Yet, it's also the first Transformers film to almost become a box office flop. In today's episode of Anatomy of a Failure, let's find out how the movie's exclusive focus on character ended up hurting it in the box office.
    Support: / filmento
    Follow: / filmento
    Honestly, Bumblebee 2018 is a good film and a definite improvement from the last few Transformers. It's interesting to see what happens with Transformers 6 and Bumblebee 2 going forward. Will we see more Michael Bay like the producer suggests? Hailee Steinfeld's character is great, so I wouldn't mind if we got more of her in the future. More John Cena is never bad either, I guess.
    Music:
    freemusicarchive.org/music/Broke_For_Free/
    #Filmento #AnatomyOfAFailure #Bumblebee
    -
    Bumblebee
    Cybertron has fallen. When Optimus Prime sends Bumblebee to defend Earth, his journey to become a hero begins. Charlie Watson (Hailee Steinfeld), a teenager trying to find her place in the world, discovers and repairs the battle-scarred robot, who's disguised as a Volkswagen Beetle. Bumblebee honest trailer. Everything wrong with bumblebee. Bumblebee cinemasins. As the Decepticons hunt down the surviving Autobots with the help of a secret agency led by Agent Burns (John Cena), Bumblebee and Charlie team up to protect the world in an action-packed adventure that's fun for the whole family.
    -
    Transformers: Dark of the Moon
    The interstellar war between the Autobots and Decepticons shifts into overdrive following the discovery of Sentinel Prime (voice of Leonard Nimoy) in this sequel from director Michael Bay. Only a precious handful of officials in the government and military realize that the 1969 moon mission was the result of an event that threatened profound repercussions for the entire human race. When the Apollo 11 astronauts discover the wrecked remains of Sentinel Prime on the surface of our natural satellite, they bring him back to planet Earth. But Sentinel Prime wasn't the only alien object on the moon, and when a malevolent new enemy makes its presence known, only the Autobots can save humankind from certain destruction.
    -
    Transformers: The Last Knight
    With Optimus Prime gone and a war brewing between mankind and the Transformers, Cade Yeager (Mark Wahlberg) teams up with a British astronomer. shazam. (Anthony Hopkins), a university professor (Laura Haddock), and the Autobot known as Bumblebee to save the world from a terrifying new threat. Along the way, the group investigate the secret history of the Transformers' time on Earth. Josh Duhamel, Isabela Moner, Stanley Tucci, and John Turturro co-star in action sequel from director Michael Bay. Bumblebee full movie. watch bumblebee online. Bumblebee hd clip.
  • Krátké a kreslené filmy

Komentáře • 5K

  • @Filmento
    @Filmento  Před 4 lety +813

    The vid has some copyright problems which is why no audio right now, check back in a couple days!
    e: should be fixed now. Tweet at me if it isn't.

    • @canttalk-busypurging
      @canttalk-busypurging Před 4 lety +13

      For a second I thought my phone was broken

    • @fleshborg
      @fleshborg Před 4 lety +3

      ....1 year later(french accent)

    • @GalvatronStudios
      @GalvatronStudios Před 4 lety +3

      The Justice League movie is better than the Bumblebee movie

    • @tylerkister4628
      @tylerkister4628 Před 3 lety +5

      @@GalvatronStudios I wouldn't say that I think this movie had more of a family feel to it best transformer movie by far

    • @Alestorm5000
      @Alestorm5000 Před 3 lety +1

      You made a typo at about 15:18. Just so you know...

  • @deathcon6261
    @deathcon6261 Před 3 lety +4998

    Filmento: Calls it a flop.
    Hasbro: "This movie gave us more of a profit then The Last Knight."

    • @mattimusprimal637
      @mattimusprimal637 Před 3 lety +557

      Death con This guy doesn’t understand the concept of profit, all he saw was that Bumblebee made under half a billion and thought it was a flop. Not taking to account its budget or marketing cost, so which was far less than The Last Knight. TLK was a flop due to the total cost being $520 million in budget + marketing and made only $602-$605M worldwide (with $130.1M domestic) while Bumblebee total cost is roughly $204M in budget + marketing and made $465-$467M (with $127.1M domestic, on a budget of $102M). So he’s just wrong!!

    • @jonathancontreras5069
      @jonathancontreras5069 Před 3 lety +311

      Mattimus Primal honestly, people these days think if it doesnt make over a billion its a flop

    • @infinitepowerTF
      @infinitepowerTF Před 3 lety +57

      @@jonathancontreras5069 Agreed 👍!!!

    • @planetschlock
      @planetschlock Před 3 lety +142

      Yeah, didn't they say in that same Hasbro press conference that Bumblebee was solidly profitable and TLK lost over $100 million after it was all said and done? I honestly don't know what Filmento is going on about here.

    • @JamesASharp
      @JamesASharp Před 3 lety +33

      So? The action scenes lacked Bayhem. The film had heart, but it was boring to me. Forrest Gump has a lot of heart, and it's a classic. The latter film succeeds where the former film fails.

  • @AaronMosmeyer
    @AaronMosmeyer Před 5 lety +5436

    The movie failed in the US for several reasons.
    1) Marketing wasn’t too great, especially since the film went up against the successful Aquaman.
    2) “Transformers” was missing from the title so casuals didn’t know what it was.
    3) Some fans that knew what it was were suffering from burnout after The Last Knight.

    • @radrno7
      @radrno7 Před 5 lety +373

      Agree with your points, but because it didn't have "Transformers" in the title? Really? The fact it's called Bumblebee, who everyone who knows Transformers knows that name, and has Bee's giant face on the poster weren't enough of a clue?

    • @windsweeper8002
      @windsweeper8002 Před 5 lety +117

      The fact that Aquaman was successful and Bumblebee wasn't is just wrong.
      I've enjoyed the D.C. movies overall but Aquaman was definitely the worst. The acting wasn't great.

    • @drinibuzali1289
      @drinibuzali1289 Před 5 lety +123

      @@windsweeper8002 yeah that's actually a very very objective opinion cause everyone including me would strongly disagree
      Aquaman was by far the best dc movie since the batman trilogy or even better the dark knight

    • @windsweeper8002
      @windsweeper8002 Před 5 lety +40

      You're entitled to your opinion and for your sake, I'm glad you enjoyed Aquaman but I have to respectfully disagree.
      I'm not looking to argue here, just expressing my opinion.

    • @orionlax626
      @orionlax626 Před 5 lety +101

      @Nagato is better than Punk Naruto TLK was good? Seriously? You've got to be kidding.

  • @crimsun3426
    @crimsun3426 Před 3 lety +926

    When they treated Bumblebee like a baby it reminded me of the time when they made Grimlock a mindless dinosaur in TF5 . Why does the leader of the dinobots want to eat a cruiser

    • @relatedfir
      @relatedfir Před 3 lety +57

      The police cruiser grimlock ate probably tastet really good

    • @j.t.dennis4900
      @j.t.dennis4900 Před 3 lety +140

      To be fair, that's something the G1 version would probably do. However, that is the only aspect of The Last Knight I will defend

    • @alyssastern6073
      @alyssastern6073 Před 3 lety +19

      because a police officer would tell the king what to do and he wasn't a strong enough leader in king grimlock's eyes

    • @MT-rl6fn
      @MT-rl6fn Před 3 lety +18

      You forget a few things, hes a dinosaur and mindless. What did you think would happen.

    • @notashark5189
      @notashark5189 Před 3 lety +1

      @@MT-rl6fn Idk? Maybe he can come up with a reason why the fuck would michael bay destroy the franchise??!?!?!?!?!??!?

  • @qwench3am553
    @qwench3am553 Před 3 lety +876

    I think he was acting like a baby because he forgot everything about himself and his mission optimus gave him

    • @247.mp4
      @247.mp4 Před 3 lety +109

      Bumblebee was always a kid in a "mans" body (arent we all) and always adapted to his friends. He was only heroic when he needed to be. Also, how should he know what a socket is without touching it

    • @notashark5189
      @notashark5189 Před 3 lety +8

      @@247.mp4 His world and his people are fucking machines... not saying they should have sockets there but they gotta charge some shit somehow

    • @stickiedmin6508
      @stickiedmin6508 Před 3 lety +51

      @@notashark5189
      But he has no memory of that world, or those people.
      He sees the thing, he can probably detect that there's electrical power flowing behind it so he decides to check it out.
      Simple enough.

    • @jaylenware363
      @jaylenware363 Před 3 lety +26

      @@notashark5189 Angry Sentinel Prime: wE aRe nOt MaCHinES

    • @coolmuzt
      @coolmuzt Před 3 lety

      @Primus Productions! Yeah when he took care of Spike he was so cute

  • @Iamkenuff
    @Iamkenuff Před 3 lety +2422

    My main complaint: how dare they tease G1 soundwave and not milk him.

  • @TedTheFatCat
    @TedTheFatCat Před 5 lety +2638

    I agree with everything but calling the movie a failure is way too harsh. It was a move in the right direction and that must be celebrated.

    • @lonestarr1490
      @lonestarr1490 Před 5 lety +160

      I think what he meant by that is that the producers consider it to be a failure.

    • @ClaireYunFarronXIII
      @ClaireYunFarronXIII Před 5 lety +228

      ...failure at the Box Office, not critically.

    • @coopergreen7961
      @coopergreen7961 Před 5 lety +3

      Yes

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 Před 4 lety +21

      It still has flaws of its own that need to be addressed.

    • @meroshango9603
      @meroshango9603 Před 4 lety +35

      Right direction??? Is a nickelodeon show wich sooo many dump moments, they ruinn transformers

  • @toadetteremotewithwiimotio3330

    They could‘ve made it so easy with one Plot:
    Find. Optimus. Prime.

    • @SlashTheWeasel
      @SlashTheWeasel Před 3 lety +83

      I like your idea of plot

    • @noirody6256
      @noirody6256 Před 3 lety +89

      but optimus said that they were also coming to earth so why should they find optimus?

    • @SlashTheWeasel
      @SlashTheWeasel Před 3 lety +175

      @@noirody6256 That is if they change the story and gave the characters a plot/something to accomplish in the story.

    • @noirody6256
      @noirody6256 Před 3 lety +15

      @@SlashTheWeasel yeah but they will need a reason to go to earth, i know it's a reboot but they're definetly gonna go to earth

    • @SlashTheWeasel
      @SlashTheWeasel Před 3 lety +27

      @@noirody6256 Johnny's plot idea was just possiblity to Filmento's plot challenge.
      I agree that reason and should go to Earth. Possiblities: search for energy to renew Cybertron. That appeared a lot in G1. Find the Matrix which was kinda done in movies one and two with the Cube/Allspark and Matrix.

  • @Seiaeka
    @Seiaeka Před 3 lety +682

    As a fan of transformers, I didn't even know this movie existed until I found it on netflix. I was honestly disappointed that I missed it in theatres. I've still watched it more than once despite there being overall no distinct plot. I still want to see more transformers movies from this film. I would gladly watch them.

    • @Scion141
      @Scion141 Před 3 lety +28

      I think the reason a lot of people missed it was the lack of "Transformers" in the title.

    • @josiahashman3067
      @josiahashman3067 Před 3 lety +37

      @@Scion141 How do you not notice it’s Transformers when it has Bumblebee plastered all over it

    • @azpiapi
      @azpiapi Před 2 lety +8

      @@josiahashman3067 right

    • @firemaker1258
      @firemaker1258 Před 2 lety +4

      There’s going to be a seventh film, Rise of the Beasts.

    • @DESTRAKON
      @DESTRAKON Před 2 lety

      I didn’t even watch it when it came out cause I was just done with tf at that point but I hear everyone saying it’s cool so I might check it out

  • @aguywithalotofopinions412
    @aguywithalotofopinions412 Před 4 lety +4103

    Bumblebee is a good movie. It's just that in order to make up for The Last Knight it needed to be perfect.

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 Před 4 lety +91

      It wasn't perfect. None of these movies are.

    • @luis7878
      @luis7878 Před 4 lety +176

      @@m.a.k.dynasty4504 then dont even bother with the series then

    • @meroshango9603
      @meroshango9603 Před 4 lety +11

      Not good at alll

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 Před 4 lety +54

      @Plague Doctor
      He said that it needed to be perfect, which is wasn't. What's with the attitude piss pot?

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 Před 4 lety +23

      @Plague Doctor
      Okay edgelord. Go back into your corner. Think about what you've done.

  • @VG-eb1kd
    @VG-eb1kd Před 5 lety +1749

    "Heroes casually hangout on earth until evil comes to wipe them." Almost every DBZ arc ever lol.

    • @Yoseqlo1
      @Yoseqlo1 Před 5 lety +62

      Hey, that's not fair! It's just half the arcs.

    • @hawoaliahmed6996
      @hawoaliahmed6996 Před 4 lety +9

      That could only be said about the radish ark

    • @robinachaibar8050
      @robinachaibar8050 Před 4 lety +27

      Yea but DBZ is a show
      Bumblebee is a movie

    • @TheDMind
      @TheDMind Před 4 lety +73

      Note that in DBZ, the evil tends to show up fairly early in the arc, or at least their presence is felt. The rest of the 'waiting around' is them training and getting ready to face the evil - there's active motion towards a plot goal by the heros pretty much since partway through act1 of the arc.

    • @idkdamn978
      @idkdamn978 Před 4 lety +4

      nah dude. They train the whole time waiting for the evil to happen. Americans love training montages.

  • @nargacuga05
    @nargacuga05 Před 3 lety +107

    Wouldn’t this argument also apply to ET then, I find the idea that “he’s an adult” is a valid argument to be flawed, his memory was corrupted, which doesn’t entail anything specific by nature, applying reason to what is and isn’t affected is more of a nitpick than anything else

    • @hamdurger
      @hamdurger Před 3 lety +38

      he also picked on the fact that bumblebee acts like a baby that would stick his finger into a socket even though bumblebee landed on a planet unknown to him. Its not like Cybertron also had sockets for some reason.

    • @jordon8658
      @jordon8658 Před 2 lety +2

      3:54 he just explained that unlike bumblebee et had an overarching plot

    • @jordon8658
      @jordon8658 Před 2 lety

      @@hamdurger they do though....but i get your point

    • @aetheriox463
      @aetheriox463 Před 2 lety +3

      @@jordon8658 they have sockets that are identical to those in the US at the time the movie was set? if that made any sense whatsoever i would still doubt it

  • @sharpwavethedecepticon6837
    @sharpwavethedecepticon6837 Před 3 lety +282

    This is why the Transformers Prime series was the greatest interpretation I have ever seen. Great overarching plot, good character development, and beautiful stylized animation. If someone make a live action movie based on that series and a lot of love was put into it, I would throw my money at them. If companies want to make a Transformers movie, look over Transformers Prime and how it’s so well structured. Use it as an example.

    • @cherry414
      @cherry414 Před 2 lety +42

      Now this guy gets it. TFP is everything the movies should've been.

    • @sharpwavethedecepticon6837
      @sharpwavethedecepticon6837 Před 2 lety +34

      @@cherry414 Honestly, imagine a movie Megatron that is as intelligent as TFP Megatron. He’s (TFP) literally the only Megatron I would take seriously. Prime also had better designs than the movies.

    • @azpiapi
      @azpiapi Před 2 lety +15

      You forgot the fights.. they were amazing

    • @cherry414
      @cherry414 Před 2 lety +25

      @@sharpwavethedecepticon6837 True! The TFP design is almost nothing like the G1 ones, which Bay wanted to do in his movies, yet TFP design is beautiful. Also Meg's design in TFP! He looks menacing, elegant and a tyrant. In the movie, he looks like every other decepticons.

    • @MeisterSchwabbo
      @MeisterSchwabbo Před 2 lety +14

      Indeed, TFP was by far the best transformers media ever created, in my opinion G1 sucks in comparison

  • @lockejawe4050
    @lockejawe4050 Před 5 lety +121

    A lonely kid finds a stranded alien robot and then the two casually hang out until the villains come for them worked well in The Iron Giant...

  • @mityakiselev
    @mityakiselev Před 4 lety +238

    "to hide Bumblebee from John Cena"
    I'm pretty sure he saw him literally in the beginning, he was standing right there

    • @jordon8658
      @jordon8658 Před 2 lety +5

      The point was to keep bee from getting john cena

    • @frde2190
      @frde2190 Před 2 lety +15

      Really hard cause John Cena is invisible

    • @geomania8533
      @geomania8533 Před rokem

      Bet Cena could beat Megatron with a punch. Wonder if they’ll have Chuck Norris in the beast wars movie

  • @fly1714
    @fly1714 Před 3 lety +67

    Filmento: "Bumblebee has no plot"
    Slice of Life Anime:

    • @austindemuynck9460
      @austindemuynck9460 Před 3 lety +15

      Tru. But this ain’t anime. This is a galactic civil war between giant transforming robots that beat the crap out of eachother because of different ideologies. Pretty sure that’s not a slice of life. Unless you mean having *Half* of Jazz

    • @icecreamhero2375
      @icecreamhero2375 Před 3 lety +11

      That's different. When you turn on slice of life anime you expect silly shenanigans. Also when a show is 20 minutes you can basically do whatever you want. A 2 hour movie is trickier.

    • @babyroxasman
      @babyroxasman Před 3 lety +3

      No I feel like SoL still have plot. They at least let you know what the entire episode is going to be about

  • @user-vw1tj4kx1c
    @user-vw1tj4kx1c Před 10 měsíci +5

    The only two things that are memorable about this movie are:
    1. The reuse of Iconic G1 designs.
    2. The fight scenes. I love how Bumblebee doesn’t just brute force through everything but uses his wits to overcome his opponents. Like he immobilized one with a chain or got the other destroyed by the colliding tanker.

  • @BiggestGal
    @BiggestGal Před 5 lety +764

    The character focus was hardly the issue, it was the overall feeling of burnout moviegoers felt over The Last Knight and Age of Extinction.

    • @cheetahluv210
      @cheetahluv210 Před 3 lety +25

      I agree

    • @Nephalem2002
      @Nephalem2002 Před 3 lety +2

      Both of which were dogshit

    • @etam8099
      @etam8099 Před 2 lety +3

      @@Nephalem2002 AOE was good tho

    • @kingslayerx1716
      @kingslayerx1716 Před 2 lety +9

      @@Nephalem2002 aoe wasn’t even that bad tbh. They just needed to lay off the unfunny jokes

    • @azpiapi
      @azpiapi Před 2 lety +2

      It was just boring in general, never rewatched it or checked it out so that isnt the problem.

  • @filipvadas7602
    @filipvadas7602 Před 3 lety +2697

    This movie is honestly better than all the Bay movies for 3 reasons:
    1) The War on Cybertron segment was basically one massive love letter to the franchise. The G1 designs, the voice actors and the brutality of the war itself was great
    2) The characters actually have personalities that make them fun to watch
    Shatter and Dropkick in particular were actually fun villains that felt unique. Alredy this gives us more than what the Bay movies gave us
    3) It actually has enough restraint to not fall into the same trap of the Bayverse, giving us orgies of explosions and halfbaked Adam Sandler level comedy every 10 minutes.

    • @bottlesalts
      @bottlesalts Před 3 lety +132

      I absolutely love character driven films. For example, Joker is probably on my list of top five favorite movies. However, I do somewhat agree that Bumblebee should have had a slightly better idea of what the plot was all about. But I seriously LOVED Bumblebee's whole character in this movie. I desperately want to see more like it in the future.

    • @frank8917
      @frank8917 Před 3 lety +78

      4) the soldier characters are actually good (especially the one played by John Cena)

    • @bottlesalts
      @bottlesalts Před 3 lety +61

      @Franco Sal John Cena’s character wasn’t too bad in the movie, however, the “boyfriend” character - i forget his name - I think was terribly developed. He really served no purpose except for being a third wheel. In ways, I feel the movie would have been better without that guy. But Cena, on the other hand, even had his own little arc sorta thing, which was pretty good

    • @Fvckjus
      @Fvckjus Před 3 lety +36

      Shit was wack with its 3 fight scenes 😭

    • @Leader7353
      @Leader7353 Před 3 lety +2

      @pinkgoat agreed

  • @caiosilva2167
    @caiosilva2167 Před 3 lety +87

    Was the lack of plot really the main problem ?
    Maybe so when taking the larger audience into account, but as a TF fan my biggest gripe is how this movie doesn´t really focus on the cybertronians as characters, it´s very human centric, Bumblebee may be the title character but i wouldn´t say he is properly fleshed out, he is mute and *amnesiac* for most of of the story and basecally acts like a puppy to Charlie who is the one to actually get the spotlight, i fear Hollywood producers still don´t trust in the Transformers to actually carry the story as characters.

    • @xgray2012
      @xgray2012 Před 3 lety +14

      Okay. That is a much better analysis, dude.

    • @geomania8533
      @geomania8533 Před rokem +4

      Least we had a plot. Unlike the bay films which have too much plot that you can’t really see what’s going on. Also the fact that their aren’t transformer scrotums or too many explosions. Which is progress for making Transformers great again.

  • @pawarl.o.s.881
    @pawarl.o.s.881 Před 3 lety +36

    That opening on Cybertron is still one of my favorite movie scenes.

  • @TheStargateNerd
    @TheStargateNerd Před 5 lety +535

    I regret not seeing this movie at the cinema, because I was surprised by how good it actually was. The opening fight on Cybertron was also amazing, even if it was woefully short.

    • @g.d.graham2446
      @g.d.graham2446 Před 2 lety +3

      True

    • @YouKnowMeDuh
      @YouKnowMeDuh Před 2 lety +2

      I mourn how little we got to see of that amazing fight sequence....

    • @MrChickennugget360
      @MrChickennugget360 Před rokem

      Same here. After watching the Bay Films i had lost all interest in the franchise.

    • @sidearmsalpha
      @sidearmsalpha Před rokem +3

      @@MrChickennugget360 Probably why this movie underperformed. I almost walked out of The Last Knight because of how bad it was. When I heard about Bumblebee, I was seeing that it would be different but I was still skeptical but I'm so glad I watched it in a theater. Easily the best one and a big step in the right direction for the franchise. I think a lot of people were expecting it to be more of the same garbage from Michael Bay and that's why a lot of people skipped it. What a shame.

    • @SnowEspeon
      @SnowEspeon Před rokem +1

      @@Holisticxoxo idk man, i appreciate a slow paced feel good sentimental story every once in a while, and we got to see bumblebee being an amazing fighter in almost every fight scene that did happen, so it was a great balance for me

  • @God-T
    @God-T Před 4 lety +633

    The one thing i liked about the bumblebee movie was the fighting choreography it looked so natural!

    • @Tremadog102
      @Tremadog102 Před 3 lety +97

      I thought it was a nice touch that when Bumblebee fought he used his opponent's size against them. It was more like martial arts compared to brawling. He couldn't afford to use brute strength to defeat his opponents so he had to fight smart.

    • @TF2Fan101
      @TF2Fan101 Před 3 lety +55

      Something else I felt was clever about the choreography, particularly whenever Bumblebee was fighting, was that he used his size to his advantage. He was able to show, through his acrobatic abilities and quick-thinking, that he could be a capable fighter.
      To quote Yoda, 'Judge me by my size, do you?'.

    • @chj2
      @chj2 Před rokem +12

      Indeed - and I LOVE the fact that the fighting style in Bumblebee actually employed TRANSFORMING for once! Shame it took almost 6 movies to see that. . .

    • @siphonophores
      @siphonophores Před rokem +5

      I just love that they used actual fighting styles instead of just trying to grab and throw each other.

    • @CaptainRockoBD
      @CaptainRockoBD Před 11 měsíci

      @@TF2Fan101that’s my favorite thing about bumblebee. He’s been like that even in the Bayverse.

  • @HinchMellow
    @HinchMellow Před 3 lety +103

    Bruh the reason why he doesn’t ack like an adult is because he lost ALL HIS MEMORIES

    • @mawa-chanmanaha7472
      @mawa-chanmanaha7472 Před 3 lety +33

      And he is in a foreign planet and is curious about things like that~

    • @HinchMellow
      @HinchMellow Před 3 lety +8

      @@damll2975 doesn’t mean they know anything about living
      They basically become a child again. Needing to relearn everything

    • @atheistmando4976
      @atheistmando4976 Před 3 lety +6

      @@damll2975 technically true. But also not true, as he was learning to converse with people. That, and language is an identity that even in people with amnesia, still are capable of processing. As well as childish manurisms, the childish manurism can be explained with PTA Post Traumatic Amnesia, where they lose all memory, but will have a tendancy to act child like. Tho i dont agree entirely with connor. It just shows how much you know about amnesia.

    • @sub-zero5433
      @sub-zero5433 Před 3 lety +3

      he should still have his soldier instincts bruh. and even if he didn’t have those he’s an adult alien robot, not a kid

    • @damll2975
      @damll2975 Před 3 lety +1

      @@sub-zero5433 exactly like there are somethings a solider never forgets like how to handle a gun or change a baby’s diaper

  • @sathirakatugaha974
    @sathirakatugaha974 Před rokem +9

    Thank you, finally someone not saying Bumblebee is the greatest thing ever

  • @siloPIRATE
    @siloPIRATE Před 5 lety +225

    This movie sounds like Iron Giant
    Find robot, army come for it, save robot

    • @trevorrogers95
      @trevorrogers95 Před 5 lety +3

      Iron Giant dies, bro.

    • @siloPIRATE
      @siloPIRATE Před 5 lety +28

      @@trevorrogers95 He doesn't. He explodes, but begins reassembly because heroes never die

    • @jeagerkej3171
      @jeagerkej3171 Před 5 lety +10

      siloPIRATE Except iron giant has a good plot and a heart warming story.
      Bumblebee is a 4K dumpster fire.

    • @jeagerkej3171
      @jeagerkej3171 Před 5 lety +2

      @Henry Louis21 If you just watched the video and still think this movie even has a plot and that would be the end of our conversation.

    • @HenryLouis21
      @HenryLouis21 Před 5 lety +18

      @@jeagerkej3171 First of all watched the video and I disagree because the movie had a plot and a story to follow. The movie's narrative was about a girl who finds a robot and needs to hide it from the rest of the world. It is mostly a teenage coming of age story that has elements of the Iron Giant and E.T

  • @TheSteelMagnum
    @TheSteelMagnum Před 5 lety +926

    Well, the Iron Giant doesn't exactly have much of a strong plot either. Aside from a young boy trying to teach a giant robot how to be human, or something like that. But its still a flawless movie.

    • @alexhorbacz1547
      @alexhorbacz1547 Před 4 lety +69

      Besides the flaw of it not having a strong plot.

    • @xgray2012
      @xgray2012 Před 4 lety +8

      Agreed.

    • @xgray2012
      @xgray2012 Před 4 lety +18

      @@alexhorbacz1547 It's better than having no plot at all.

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 Před 4 lety +23

      @@xgray2012 That's doesn't change the fact that it's plot is still pretty weak in general.

    • @aidenshigaraki1998
      @aidenshigaraki1998 Před 4 lety +14

      that's not a fact, that's your opinion that it has a weak plot, its better then the weak what the hell plots in the bay movies, those are bad

  • @Presto5L
    @Presto5L Před 2 lety +87

    Bumblebee really gave me what I wanted, the story, the characters, funny and light hearted comedy, and that absolutely wonderful war on Cybertron scene. When you watched it you didn't feel like you were watching giant robots battling it out for control of the planet, it was like looking at humans fighting over whatever we'd fight over. That and Soundwave coming through with the vocals in the middle of the war.

  • @ShadowReaper-pu2hx
    @ShadowReaper-pu2hx Před rokem +4

    I always liked the Michael Bay Transformers movies and still like them more than the new ones.

  • @ToonamiT0M
    @ToonamiT0M Před 5 lety +1998

    Transformers fans saw Bumblebee. Normies saw Bayformers.

    • @kobeskreations6932
      @kobeskreations6932 Před 5 lety +21

      ToonamiT0M Truth!

    • @IP_Films01
      @IP_Films01 Před 5 lety +7

      Yup

    • @FP19487
      @FP19487 Před 5 lety +18

      That doesn’t help anyone.. Surely there’s some way to connect both world. Imo Bee looks way too ‘Bayformers’ than it should be unlike OPrime.

    • @cosmicspidermanx9569
      @cosmicspidermanx9569 Před 5 lety +8

      I was gunshy after the last 5 movies that's not my fault that's Hollywoods. And I'm only buying the bluray for the cybertron scene, im just done with people in these films. Hell I'd take a cheesy live action remake of the 80s film

    • @andrewphillips8341
      @andrewphillips8341 Před 5 lety +4

      To bad they could make the human characters remotely interesting

  • @arnold3768
    @arnold3768 Před 4 lety +612

    Filmento: Bumblebee doesn't have a plot.
    Cats: am I a joke to you?

    • @apersonwhomayormaynotexist9868
      @apersonwhomayormaynotexist9868 Před 3 lety +22

      The thing is, Cats isn't supposed to have a story and that's the thing that works in its favor. The movie was terrible but the Broadway show is one of the all time greats. This is a movie that could use more plot

    • @swiftstreak98
      @swiftstreak98 Před 3 lety +29

      @@apersonwhomayormaynotexist9868 How dare you compare Bumblebee to that heaping shit pile

    • @apersonwhomayormaynotexist9868
      @apersonwhomayormaynotexist9868 Před 3 lety +4

      @@swiftstreak98 I'm saying this is better then the cats movie, just not the show because the show is an all time great

    • @swiftstreak98
      @swiftstreak98 Před 3 lety +1

      @@apersonwhomayormaynotexist9868 The show is just as bad

    • @apersonwhomayormaynotexist9868
      @apersonwhomayormaynotexist9868 Před 3 lety +9

      @@swiftstreak98 I'm gonna take a wild guess and say you've either never seen the show or hate musical theater with a burning passion. Either way, you're not an unbiased critic. I'm someone who loves musical theater, but also loves action movies, so yes I'm biased, but much less so. Plus, I've actually _seen_ both so...
      Also just look at the critical reviews by the people who _are_ unbiased, they agree with me.

  • @horrorbeyondhumancomprehension

    I loved Bumblebee so much, it's my favorite transformers movie. I agree that the plot was slickly lacking, but the characters were enjoyable to watch, so that made up for it. Also, just because a movie doesn't make much money more than it's budget, does not mean it's a flop

    • @geomania8533
      @geomania8533 Před rokem +2

      Plus we could follow along to the story. Unlike the bay films where the plot would lead to one thing then another then another.

  • @shadowgames6164
    @shadowgames6164 Před rokem +4

    The story is actually more close to the iron giant, and it’s obvious in the scene where bumblebee gets red eyes and starts shooting until charlie comes in to talk and stop him

  • @Lodogg
    @Lodogg Před 5 lety +645

    I actually enjoyed it, reminded me of the true Transformers from the 80’s.

    • @viper13178
      @viper13178 Před 5 lety +36

      agreed and the gen 1 looks made it even better

    • @antpain1156
      @antpain1156 Před 5 lety +23

      yes..the movie is very enjoyable

    • @Draconicus702
      @Draconicus702 Před 4 lety +32

      That may be the very issue of the movie... believe it or not, but alot of people actually like the Michael Bay movies and their more unique take on what an advanced alien race of robots eould look like... whether said robots were under used or not.
      Not everyone sees G1 designs and instantly falls in love, some people aren't huge fans of the simple blockier designs of the 80s cartoon characters.
      Personally while i didn't hate the Bumblebee movie in anyway, I'd be lying if i said i at all enjoyed how Soundwave, Shockwave, Ravage, or most of the Autobots looked.

    • @Mrenderboyo
      @Mrenderboyo Před 4 lety +4

      Yeah it did for me too
      Until bumblebee met the girl then it just went downhill

    • @JB-bq2qj
      @JB-bq2qj Před 4 lety +13

      There’s nothing wrong with enjoying something even if it has problems.

  • @an_exlusive_channel
    @an_exlusive_channel Před 5 lety +856

    I like the character design in bumblebee, it's very reminiscent of the old cartoon series

    • @spideyguy3315
      @spideyguy3315 Před 4 lety +38

      It gives me that transformers vibe like the cartoon

    • @bradleyrenfroe2776
      @bradleyrenfroe2776 Před 4 lety +43

      @@spideyguy3315 That Vibe the Bayverse was missing.

    • @jareejones
      @jareejones Před 4 lety +40

      I personally hate the design its looks fake tbh Bays looked real and detailed

    • @an_exlusive_channel
      @an_exlusive_channel Před 4 lety +41

      Jaree Jones yeah Bay’s designs are pretty cool but I personally love the cartoon style

    • @spideyguy3315
      @spideyguy3315 Před 4 lety +9

      @@bradleyrenfroe2776 exactly

  • @MAN-zg7dj
    @MAN-zg7dj Před 3 lety +223

    This design of bumblebee is literally the best one.

  • @neonbunnies9596
    @neonbunnies9596 Před 3 lety +10

    0:28 Flimento: For years and years, Paramount releases loud mindless action movies that make billions of dollars at the box office
    Transformers: The Last Knight: *Are you challenging me?*

    • @primus0348
      @primus0348 Před 3 lety +1

      More like: Who dares to challenge me

  • @oliaustfjor6247
    @oliaustfjor6247 Před 5 lety +1287

    Yeah, because a 93% on Rotten Tomatoes with the studio being so happy with it they confirm it as a reboot and with sequels like it in mind is a failure...
    Sure.

    • @galvanizedcorpse
      @galvanizedcorpse Před 5 lety +57

      so what is your problem, do you have one? speak it loud, not with feminine sarcasm sissy boy

    • @oliaustfjor6247
      @oliaustfjor6247 Před 5 lety +366

      Гальванизированный Труп
      Didn’t know sarcasm was considered feminine nowadays.
      But hey, it’s 2019.
      Learn something new every day

    • @THEKXRMANETWORK
      @THEKXRMANETWORK Před 5 lety +144

      Гальванизированный Труп bitch people like you think everyone is a feminist who likes this movie bruh people just like Transormers shut the fuck up bruh damn

    • @oliaustfjor6247
      @oliaustfjor6247 Před 5 lety +102

      ERROR-TRI
      Love the 86’ film.
      I’ve seen every live action film in theatres since 2007.
      Love the first bay film.
      Didn’t care for the sequels.
      Loved Bumblebee.
      It’s like a really long episode of the 84’ show and that’s why I saw it three times.
      Don’t jump to conclusions like that, my man.
      Die hard transformers fan right here and have been since I was a kid.

    • @oliaustfjor6247
      @oliaustfjor6247 Před 5 lety +81

      LOL, now just realizing you were replying the jerk who called me a feminine sissy.
      Sorry, my mistake, hahaha

  • @Warhammer_lover
    @Warhammer_lover Před 5 lety +394

    Why do you compare bumblebee to E.T and not to “Iron Giant” ? I think it would be more accurate comparison IMHO

    • @tiagodarkpeasant
      @tiagodarkpeasant Před 5 lety +78

      because the iron giant was created to be a villain but discovered he could be anything he wanted, that is an entirely different plot than "et call home"

    • @VinWeiLee27171
      @VinWeiLee27171 Před 5 lety +19

      Bumblebee at one point feels very villainess. So I do think the comparison is valid. They decide not to expend that idea, probably because in the first scene we already know bumblebee is supposed to protect earth.

    • @hansruhlmann454
      @hansruhlmann454 Před 5 lety

      василий петрович Just what i thought too.

    • @NerdiconPrime
      @NerdiconPrime Před 5 lety +22

      @@tiagodarkpeasant Well the iron giant is ET if he were a giant alien robot Gun. They share the same story beats of; Human finds alien, befriends alien, helps alien both physically and emotionally, hides alien from Government, alien gets or almost gets caught, Human rescues alien or calms them down, Alien says goodbye to human Fin.

    • @NerdiconPrime
      @NerdiconPrime Před 5 lety

      Upcycle Shoes why’d you find it trash if it’s okay for me to ask?

  • @KR-P
    @KR-P Před rokem +4

    You were right about the studio's reaction to critique/criticism. Also Rise of the Beast has similar plot issue: Noah is about to destroy the transwarp (weird name) key which will stop Unicron from reaching earth ✅ But then he decides not to cuz...Optimus ❌. This scene could have been cut or made into a conversation and the plot would be unchanged. But imagine if Noah followed through but failed or even crazier actually succeeded in destroying it!

  • @defalt30
    @defalt30 Před 3 lety +45

    "Why does he act like a dumb little baby"
    That made me die of laughter 😂😂😂

    • @mrmercy554
      @mrmercy554 Před 3 lety +11

      You know good question oh wait it’s not literally the movie tells you why.he lost his memory at the beginning it told you that at the end of the blitzwing fight,it said “memory core failure”.

    • @NurseAmamiya
      @NurseAmamiya Před 3 lety +4

      It's no surprise. Bumblebee acted similar in the first three bay films too.

    • @ultar2105
      @ultar2105 Před 3 lety +1

      @@mrmercy554 i hated blitzwing he didn't even look like from G1.

    • @youngmelo4963
      @youngmelo4963 Před 3 lety

      @@ultar2105 knight straight up said sorry about how blitzwing looked

    • @ultar2105
      @ultar2105 Před 3 lety

      @@youngmelo4963 he said that?? Even though he was the who made the movie.

  • @rosea4592
    @rosea4592 Před 4 lety +454

    The movie was amazing. The reason it failed was very one went to see aqua man . Everyone I knew said “ nah let’s go see aqua man “

    • @mrmercy554
      @mrmercy554 Před 3 lety +17

      I mean your right and tbh the Aqua man movie wasn’t that good

    • @Terminal_Apotos
      @Terminal_Apotos Před 2 lety +16

      I’m a DC fan but honestly I’m Surprised Aquaman was able to carry his own movie and beat a Bumblebee Movie who’s arguably a more popular character.

    • @YouKnowMeDuh
      @YouKnowMeDuh Před 2 lety +1

      Oh that's sad. What I've seen of Aquaman was not very thrilling, lol.

    • @cloudystorm7314
      @cloudystorm7314 Před 2 lety +6

      It didn’t really fail though. Overall it made 467 million. This video just showed the domestic gross

    • @dannyjp-diego2938
      @dannyjp-diego2938 Před 2 lety +3

      AND Aquaman have more issues than bumblebee's plot

  • @enderdrone6432
    @enderdrone6432 Před 5 lety +594

    Or they could have focused the story ENTIRELY on Cybertron than Earth.

    • @TheManOfMyriad
      @TheManOfMyriad Před 5 lety +110

      Imagine animating Cybertron for a whole movie. In our modern style.
      I'm not sure the movie budget would've lasted, even with added extras.

    • @HenryLouis21
      @HenryLouis21 Před 5 lety +72

      First off, what story is there to tell about Bumblebee on Cybertron, sure there could be a lot of cool stories of him on Cybertron. But Bumblebee's character is a character who has a strong relationship with humans and strong connections with them. So making a movie about him on Earth with a bunch of human comrades is an interesting one.

    • @ryanbarker5217
      @ryanbarker5217 Před 4 lety +1

      @@HenryLouis21 it could have been an interesting one with a better writer and director. as it stands, it's everything wrong with modern 'cinema.' i agree, just being on cybertron is pointless... that is, even more pointless than cheap cash money grab prequels are to begin with.

    • @HenryLouis21
      @HenryLouis21 Před 4 lety +12

      @@ryanbarker5217 First of all, this is not a fucking prequel, its a reboot. This has literally been announced from like a year ago. Do your research.

    • @KevinLopez-cz9xs
      @KevinLopez-cz9xs Před 4 lety +25

      Umm... have you heard of fall of cybertron? Yes, it’s a game, but at the same time, it gives a movie-like experience what with all the character interactions and cutscenes

  • @noahfuc7131
    @noahfuc7131 Před rokem +4

    I think it could’ve been pretty neat for Optimus to have initially given a real debrief to Bumblebee, but it glitched out or broke and all he got through was ‘Protect the Earth’. It’s an intangible and confusing goal. It could just be Bumblebee trying to figure out what the hell that means by finding Optimus or doing something else, or just entirely misinterpreting the message for comedy

  • @IeamNoon
    @IeamNoon Před 3 lety +10

    When a human met with a friendly alien in a movie, most of the time alien act as a puppy. 🤣🤣🤣

  • @fawnw7778
    @fawnw7778 Před 3 lety +539

    focus on the character didn’t kill it, aquaman did thats literally it

    • @calebweldon8102
      @calebweldon8102 Před 3 lety +59

      Yes people always try so hard to get why movies don’t make money but it’s usually just (competition)

    • @dr.boring7022
      @dr.boring7022 Před 3 lety +55

      Not just Aquaman, but the best movie to come out around that time: Spiderverse

    • @IconicProps
      @IconicProps Před 3 lety +2

      Except Aquaman was garbage. Which boggles.

    • @lye27
      @lye27 Před 3 lety +2

      @@IconicProps 1B in theaters buddy. How is that garbage?

    • @ogrimzyz8643
      @ogrimzyz8643 Před 3 lety +6

      @@IconicProps yeah aqua man is ok, but it dominated the cinemas when it came out

  • @mrsirdba
    @mrsirdba Před 4 lety +55

    I feel like the plot is driven by the deceptions, they have goals, the autobot side is character, deceptions are plot

  • @KneeCapHill
    @KneeCapHill Před 2 měsíci +2

    When I'm in a terribile movie take competition and my opponent is filmento: 🤯🤯😱

  • @jonathancontreras5069
    @jonathancontreras5069 Před 3 lety +13

    i mean bumblebee was supposed to protect earth, wasnt till the decepticons showed up that he had to do some, what else could he have done besides getting to know charlie, dude was confused on his ‘ no plot’

  • @botbee2316
    @botbee2316 Před 4 lety +142

    Here’s the thing, I think that the explosions have a reason to happen in Bumblebee. If an asteroid with an autobot or deception in it it will crash down hard! Also considering Shatter and Dropkick ran into a gas station.

    • @minchai2943
      @minchai2943 Před 2 lety +17

      These are the justified explosion

    • @orhandalegend
      @orhandalegend Před 2 lety +9

      i mean in the bayverse movies even their machine gun rounds cause mini explosisons to pierce enemy armor

    • @aetheriox463
      @aetheriox463 Před 2 lety +6

      @@orhandalegend crosshairs falling over literally caused explosions

    • @orhandalegend
      @orhandalegend Před 2 lety +3

      @@aetheriox463 have you heard of dust and sparks?
      seriously, if you are calling sparks explosions, the you shouldnt criticize the movies

    • @aetheriox463
      @aetheriox463 Před 2 lety +1

      @@orhandalegend no no they were actual explosions, just small ones. it was in TLK when cogman broke his finger. if it was just dust then sure but it wasnt, it was a few mini explosions

  • @DCRStudios
    @DCRStudios Před 5 lety +334

    Bumblebee wasn't a box office failure, yes, the movie doesn't compare with the money made by Bayformers but for a movie of 100m, 500m worldwide is not bad.
    But I agree that the movie have weak story but great characters.

    • @fearingvirus4156
      @fearingvirus4156 Před 5 lety +13

      yeah, but given the studio only takes a MAXIMUM 65% cut of the box office, with far less coming from China (where they made most of their money), add in the marketing budget, and they probably made a relatively tiny amount of profit.

    • @adarkwind4712
      @adarkwind4712 Před 5 lety +5

      FearingVirus and in understanding you’re trying to restart a franchise many have come to loathe and hold in disdain having multitudes of happy moviegoers and reviews. You can look on that small profit and understand you’re not starting at the beginning you’re starting in the red because you have to build up that trust again. So small profit yes but if they keep going with movies like this focusing on the transformers, it’ll make money.

    • @fearingvirus4156
      @fearingvirus4156 Před 5 lety +4

      ADARKWIND all of which I understand and agree with. I was just trying to make OP, and anyone who reads his comment, aware that while the movie may not have technically performed “badly”, it didn’t exactly perform “good” either, when all factors are considered.

    • @dan200tf6
      @dan200tf6 Před 5 lety +4

      @@fearingvirus4156 yet the studio confirmed it was profitable so were good

    • @fearingvirus4156
      @fearingvirus4156 Před 5 lety +3

      Dan200 Tf ....right. Once again. Didn’t dispute that it MADE profit. I was just pointing out that it didn’t make MUCH. It’s like if you ran a business that you put $10,000 dollars into creating, and made back $10,005. Technically you made a $5 profit, but that doesn’t inherently mean your business was very successful.

  • @jimjiminy76
    @jimjiminy76 Před 3 lety +6

    The "voice search" idea is really good! Definitely would have improved this film. It was a good movie, but dragged because of what you said - lack of directed plot.

  • @soundrogue4472
    @soundrogue4472 Před 3 lety +3

    1:53 you do realize they mean MICHEAL BAY LEVEL of BOOM not the normal amount of boom.

  • @rsfilmdiscussionchannel4168
    @rsfilmdiscussionchannel4168 Před 5 lety +132

    A flop, despite the fact that it ultimately made back it's money, has now been branded as a reboot and has a sequel in the works. It struggled for sure, but it ultimately came out well.

    • @bruceleeds7988
      @bruceleeds7988 Před 5 lety +1

      Wow not even YOU said the movie is good

    • @rsfilmdiscussionchannel4168
      @rsfilmdiscussionchannel4168 Před 5 lety +10

      @@bruceleeds7988 It is. Most people thought it was, so I didn't feel like stating that.

    • @natesmodelsdoodles5403
      @natesmodelsdoodles5403 Před 5 lety

      @@rsfilmdiscussionchannel4168 exactly. it'd be a fairly redundant thing to say.

    • @m.a.k.dynasty4504
      @m.a.k.dynasty4504 Před 4 lety +2

      @@rsfilmdiscussionchannel4168 Not everybody thinks that way about it though.

    • @knucklejoe26
      @knucklejoe26 Před 4 lety +7

      @@m.a.k.dynasty4504 and not everybody thinks its bad, what's your point?

  • @BangDoMusic
    @BangDoMusic Před 4 lety +117

    I was 30 years old when immigrant legally to the U.S. My mission is to have a job and support the people who raised me up in my hometown. I went to ESL class to learn English and I felt like I was a 5 years old boy - tried to figure out the language and everything. Then after 1 year I went to college made friend with 18 year-old friends and even younger guys at my part time job, which made me feel like i was a teenager. That proved that the plot you pointed out here is haven't formed yet since this is the very beginning time of Bumblebee on Earth, where he has to kick start again in a new place, made friend with a little cute human, feel like "how the hell she's so sweet but have too much emotional struggles". He got influenced by the new friends (just like I treated my first American friends like gods), and still figure out the new place during this movie. The director had put himself in Bumblebee - an Alien- a foreigner in a completely new place. I love this movie because empathized with the bot, and the kid, somethings that Michael Bay was totally fail.

    • @shinchanindia6306
      @shinchanindia6306 Před 2 lety +7

      your comment is totaly true btw loved your life story mate

    • @minchai2943
      @minchai2943 Před 2 lety +2

      I feel ya mate

    • @BangDoMusic
      @BangDoMusic Před 2 lety +4

      Thanks for your empathy, Shinchan, Min, Sweetblackblood,

    • @shinchanindia6306
      @shinchanindia6306 Před 2 lety +1

      @@BangDoMusic welcome bro hope you live great life

  • @christiandaniel3714
    @christiandaniel3714 Před 3 lety +3

    6:45 maybe when he loss his memory he lose his personality, like in Cybertron hes a badass soldier manage to kill many decepticons, but after Blitzwing kick his ass and memory maybe he also lose his personality (badass - baby)

  • @ariotriwibowo
    @ariotriwibowo Před 3 lety +4

    12:59 about his father and his...
    BOY!!!

  • @Galimeer5
    @Galimeer5 Před 5 lety +586

    If Bumblebee came out before the crapfest that was the conclusion of Michael Bay's Transformers, the movie would've done exceedingly well.
    But to the average movie-goer, they see a movie poster for Bumblebee and think "Oh, another bad Transformers movie. No thanks"
    That's why Bumblebee was a flop Stateside -- because the "Bayformers" left a sour taste in everyone's mouth.

    • @mikumikuareka
      @mikumikuareka Před 5 lety +33

      >"Oh, another bad Transformers movie. No thanks"
      Ah, yes, you're right. That's the reason I didn't go to the cinema as I always do.
      I actually enjoyed the first 3 Bay's Transformers. Maybe it's not kind of movies with "deep meaning" but, oh boy, IMHO they were very entertaining.
      But after that... It just became lame and stupid as fuck. No good plot (comparing to previous ones), no good ideas (comparing to previous ones), action scenes were boring (just boring), CGI and special effects became ugly and lazy and of course OF FUCKING COURSE A LOT OF PRODUCT PLACEMENT WHAT THE FUCK MICHAEL DID I PAY TO WATCH ADS THAT I ALREADY WATCH 24 CURSED HOUR EVERY CURSED DAY OF MY CURSED LIFE FREE OF CHARGE WHY MICHAEL WHY JUST WHYYYY
      Um yeah, I didn't enjoy that. So my expectations were low, I didn't want to face this kind of disappointment again and I decide not to watch Bumblebee at all.

    • @robertlopez7888
      @robertlopez7888 Před 5 lety +4

      @Adrijana Radosevic You saying? The Blitzwing scene was a show of sounds and explosions in cinemas, everybody was enjoying it

    • @thecartooncynic
      @thecartooncynic Před 5 lety

      but there's still no plot

    • @tfcollect2690
      @tfcollect2690 Před 5 lety +8

      That's BS.
      I see nothing but excuses for the lack of domestic success of this movie. If they would've started with BB before Beyverse. There would be no more TFmovies. Here's why.
      The 80s cartoon version woukd never play well in a real life timeline. What you seem to not think about is this. My kids were born in the 90s. What they see is what relative to their timeline.
      80s flatnose truck, VW Bettle, walking Tapedeck that ejects cassette tape looking transforming robots
      Transformers that has earth looking car parts that has never been to earth. Why does a robot on cybertron has rescue insignia on him "Ratchet" windshield wipers, etc. Robot jets that look like their from earth but they transform into alien jets.....does that make sense?
      This is why they didnt take that route in the Beyverse because that 80s era is over and it would not translate well in a live action film. And in 2019....they were correct and the domestic failure proved it. Whether you like it or not. The Beyverse made more sense. They didnt look like nothing on earth, they're not from earth. So having a protoform made sense.
      Again, my kids are born in the 90s. They were teenagers when the movie came out. Every vehicle was relative in their timeline. Soundwave being a satellite made logical sense than a damn tapedeck. Seeing them scan a vehicle to take on a disguise from their alien bodies made sense. To have them not look like anything relative to earth vehicles while living on Cyberyron makes sense.
      And let's not forget every movie had a plot and sub-plot. No matter how cheesy.
      1. Boy finds car robot/ searching for the cube
      2. Boy wants to save robot leaders life/ matrix of leadership/star harvester
      3. Robot leader finds mentor/Sentinal Prime/turns traitor/ pillars to bring Cybertrin to earth and turn earthlings into slaves to rebuild Cybertron
      Are you catching on?
      Regardless of what happened in between there was a purpose from point a to point b. The BBM had none of it. No plot relative to BBs purpose for even being on earth. And nothing he did throughout established that. Then you have a girl teaching a warrior robot how to hide?....anyway. this was a good movie. But I'd rather watch the Transformers Movie one. DOTM, AOE. over this any day. I'm a 70s baby. I grew up on G1. But I also understand that this is new age. The G1 cartoon and movie was great for my generation. The live action G1 generation if the Transformers is for my kids who are now adults and still love their Beyverse G1 generation. That's for them. Who am I to infringe on their generation? I had mine and now I'm enjoying theres and proud to know that their generation of the transformers was inspired by mine. By which I get a better since of appreciation for Bayverse.

    • @thanhclips
      @thanhclips Před 5 lety +4

      It was that simple. The last transformers movie bombed and the fans had enough. They weren't gonna go watch it. Look at X-Men 3. It did great bc X-Men 2 did great even though it was a bad movie. Having the previous movie doing good helps the next one.

  • @EmeralBookwise
    @EmeralBookwise Před 5 lety +460

    Bumblebee made nearly as much money as Last Knight on only half the budget. Doesn't sound like a failure to me. If any thing it looks more like proof of how cost ineffective Bayhem is.
    Also, the movie doesn't lack a plot, it's just telling a different kind of story, one that leans more into the slice of life genre.

    • @mr.cuttystabby5331
      @mr.cuttystabby5331 Před 5 lety +50

      And far too many people dislike slice of life type movies, myself included, but every now and then we get a gem like Bumblebee. The movie was solid and I can't wait for the next one.

    • @LinkMarioSamus
      @LinkMarioSamus Před 5 lety +19

      This is what I was thinking, yes. I understand most of what is said in the video is from the perspective of how it could have been marketed better, but sometimes in life things do happen and people take actions for seemingly no reason. That's not to say every movie should be like that, but more that that's simply another form of storytelling.
      Admittedly I have not actually seen this film (I get the feeling I will though), but from what I gather about it, a film like this might represent a turning back to old-style movies that people went to see just to watch people hanging out, like an Easy Rider, Midnight Cowboy, or American Graffiti. Although I haven't seen those films either so I'm largely going off of what they're supposed to be about, but still. Not everything needs to have a clear Point A and Point B.
      I still get the point but come on, this is clearly not a high-concept film and was never meant to be.

    • @LeaderOfTheLostSouls
      @LeaderOfTheLostSouls Před 4 lety +22

      No I watched the movie and I agree it has no plot, you can be a slice of life story yet have some goals or a background plot for the characters. Characters can have their personal own goals, Charlie did have a small one connected to her father’s car which she dropped once she got bumblebee, sadly, and bumblebee lost his goal for most of the movie due to memory loss, the villains had goals tho.
      Also most of the time the Slice Of Life stories are better for shows and anime not movies.
      But fair point on how well it did compared to the Last Knight, the movie makers and causal people are just dumb thinking if it’s smaller numbers it’s bad even though it did good for its cost and such.
      Also it doesn’t need to be a “High Concept Film” to have a plot or characters to have goals lol

    • @alexhorbacz1547
      @alexhorbacz1547 Před 4 lety +5

      Anyone who says that this movie doesn't have a pot hasn't seen E.T considering they are almost identical.
      So that argument kind of sucks.

    • @LeaderOfTheLostSouls
      @LeaderOfTheLostSouls Před 4 lety +7

      Alex Horbacz Ummm no
      The video itself mentions E.T. and the fact it had goal(s) and plot so idk what you are on lol
      It was mentioned at 3:45 and he points out the differences so no your memory, counter, and eyes/ears suck cuz it was touched upon.
      How about watch the movie for more than a few seconds or minutes before you say stuff that is talked about in the video and look like a fucken moron talking out of your ass.

  • @phatxsr20
    @phatxsr20 Před 3 lety +11

    I agree with you that there is no plot. But instead of finding his voice box, it should be him trying to find a sort of key device that he lost during the first battle with the Deceptions and when he finds it, Bumblebee will use it to turn on Teletraan One where it will release earth’s first line of defense (while Bumblebee waits for Optimus to show up). The first line of defense would be the Dinobots.

  • @bbuny10
    @bbuny10 Před 3 lety +3

    Instead of them asking “ok what are the characters doing now?”
    They probably were asking “ok, what else? What else can we do to show character”

  • @GridCube
    @GridCube Před 5 lety +157

    they have already said there's gonna be a sequel to bumblebee, because it was a success for the budget it was given.

    • @atom104n
      @atom104n Před 5 lety +14

      true but they are gonna add more Bayhem to help with the "problem" they saw with Bumblebee which I am not looking forward too. Bumblebee is a great movie in my opinion, and it should improve on as it goes and not go back to the Bayhem we had with the transformers series

    • @VinWeiLee27171
      @VinWeiLee27171 Před 5 lety +3

      I think bumblebee is a testing ground. The goal for the company seems to be breaking even with this reboot, not a massive box office number. They did hit their goal, so make sense to have a sequel with more fights.

    • @TalkingAboutYooh
      @TalkingAboutYooh Před 5 lety +1

      @@atom104n More Bayhem? Says who? You? Source please.

    • @atom104n
      @atom104n Před 5 lety +3

      @@TalkingAboutYooh Sorry, I should of put "probably going to add" as speculation on what they were going to do with the series.

    • @kennethsatria6607
      @kennethsatria6607 Před 5 lety +8

      @@atom104n Oh dear, I hope that just means a little more explosion... I absolutely loved the detailed fight choreography of Bumblebee.
      Optimus with his size and power flips and locks enemies, Bee tackles and grapples around them and even uses the blade more
      I am hoping to see an Optimus and Megatron fight where they get physical like what we see

  • @171QA
    @171QA Před 4 lety +134

    Whenever I want a good laugh, I come back and watch this video and reread the news that says Bumblebee is now part of a new film reboot. XD

    • @shanonfree8210
      @shanonfree8210 Před 3 lety +4

      Wait, really?

    • @poodn4559
      @poodn4559 Před 3 lety +13

      @@shanonfree8210 yep, completely new universe

    • @swiftstreak98
      @swiftstreak98 Před 3 lety +18

      @@poodn4559 Thank Primus

    • @mizaelmendez3843
      @mizaelmendez3843 Před 3 lety +5

      Who would be directing it? Please say it’s not Michael Bay!

    • @poodn4559
      @poodn4559 Před 3 lety +16

      @@mizaelmendez3843 I mean, probably Knight. The guy who did this film

  • @joshcabebe2625
    @joshcabebe2625 Před 3 lety +3

    I love the way that you're just being honest and straight but sometimes i just can't help but laugh so hard 😂
    Like when you were comparing bumblebee and e.t's plot🤣

  • @dusanrenat5567
    @dusanrenat5567 Před 3 lety +3

    3:10 Btw, this scene is basically Bumblebee repeatedly hitting her in the head with steel rods. I know how it was meant, but I don't believe for a second those metal fingers are capable of this level of gentle touch.

  • @justanothergeek6379
    @justanothergeek6379 Před 5 lety +93

    And you talk about there being no subsatnce to drive the plot ,well you could also argue that adventure and charlie's quest to get over her dads loss is something that drives the plot.

    • @aztn19
      @aztn19 Před 5 lety +7

      Just another geek true, though it has nothing to do with Bumblebee’s amnesia nor mission to protect Earth. This movie has the same problem as Solo: it was a side story that was expected to make as much as the main franchise films

    • @Team974
      @Team974 Před 5 lety +1

      True. But the movie is called bumble bee.

    • @LeaderOfTheLostSouls
      @LeaderOfTheLostSouls Před 4 lety +2

      Just another geek She did have that goal and it was connected to the car she was trying to fix till she gave up and got bumblebee which is a bit Eh
      But yeah I see what you mean overall
      I enjoyed the movie but it could of been handled better with the goals of the characters cuz it can be about personal goals if done well

  • @predaking8230
    @predaking8230 Před 5 lety +116

    Bumblebee is more in line with the Iron Giant rather than E.T. And he was acting childish because he lost his memories and was exploring a new, strange world.

    • @MoLetalis
      @MoLetalis Před 5 lety +5

      True, but the Iron Giant is basically E.T. but with a robot.

    • @predaking8230
      @predaking8230 Před 5 lety +3

      @@MoLetalis Because E.T. came first. If it was the opposite, if Iron Giant had come before E.T., then we'd be having the same conversation but flipped.

    • @MoLetalis
      @MoLetalis Před 5 lety +1

      @@predaking8230 exactly my point. Iron Giant = E.T. but more people know E.T. because it's a more original and classic movie than Iron Giant

    • @predaking8230
      @predaking8230 Před 5 lety +1

      @@MoLetalis Your point isn't valid. Saying E.T. is better because it did the "Person and their other-worldly companion" trope doesn't mean anything. It just did it first, like I said. You wouldn't compare HTTYD to E.T.? Both play the trope, but instead of an alien one's a dragon.

    • @MoLetalis
      @MoLetalis Před 5 lety +1

      @@predaking8230 Why do you keep bringing up these other subjects? I never said E.T. is a better movie. I'm just saying it's a more widely known and original movie and that therefore Filmento is comparing Bumblebee to that film. He could also have compared it to Iron Giant, yes. But it is not as famous and is just one of those films that is more or less the same as E.T. but with a slightly different setting, but also fun to watch.

  • @adityaxxanand
    @adityaxxanand Před 3 lety +6

    But I don't want a philosophy lesson, I want to see big robots fight with big monsters. Am I a bad person?

    • @austindemuynck9460
      @austindemuynck9460 Před 3 lety

      Nah. You aren’t. Only problem is When you have too much action in every single movie. It just gets a bit tedious.
      From my point of view what seperates transformers from something like the Recent Godzilla and Kong movies. Is the fact that Kong and Godzilla to a degree can’t be relatable. I mean. They’re giant skyscraper sized Monsters who beat the crap out of other monsters to protect humanity or to achieve their goal. Such as in Godzilla KOTM. While Godzilla isn’t as destructive, he sticks to his main goal, that being to kill king Gihdorah.
      Transformers on the other hand to a degree are Relatable. We can communicate with them, understand why they are fighting for what they are, and how they operate and function. Optimus being the leader. Megatron being the same on the enemy side. The reasons why our characters fight is as much important as the ways they fight.
      For example look at Infinity war. They made Thanos into more of an antagonist rather than a pure villain. Because he stood against what the Protagonists wanted. In the OG G1 comics and films. For the most part. Before Megatron created the deceptions he was a gladiator but also an outspoken Transformer. He spoke against the societal Enginnering that had been going on for eons. Where your form would dictate your fate and function. But after being betrayed by close friends, and even being made a joke in front of the high council in front of Optimus. (Back then known as Orian Pax) his goals changed. Because he knew the only way change would happen is by force. That’s why he fights. But the unique thing is that much like Thanos to a degree. His goals corrupt overtime. Thanos’s ideals soon transform him into a mass scale genocide maniac. And Megatron turns into a Ruthless dictator Set on destroying every last autobot and re-unite the Cybertronian race. As he puts it himself in a comic “Peace through tyranny.”

    • @austindemuynck9460
      @austindemuynck9460 Před 3 lety +1

      Also sorry for making a long ass essay on this. So I hope you don’t mind reading lol

    • @sebastiaankrul2403
      @sebastiaankrul2403 Před 3 lety

      @@austindemuynck9460 imo godzilla and kong can be pretty relatable. Kong just wants to go home and find his family. In his situation, who wouldn't. Same for godzilla. He just wants to be left to be without being disturbed by things that threaten him

    • @austindemuynck9460
      @austindemuynck9460 Před 3 lety

      @@sebastiaankrul2403 yes, but in this case, the original point of such Characters was giant big monster movies. Like in the Original Japanese films. Meanwhile the Original Transformers. Well, I guess TV shows had actually characters and Depth, at least to a degree.

    • @sebastiaankrul2403
      @sebastiaankrul2403 Před 3 lety

      @@austindemuynck9460 yeah okay fair point. btw, I do find it funny that despite being criticized for bad characters, godzilla kotm had a better balance between story and character than every live action transformers movie

  • @spiderguycoolwebzfororigin9532

    I feel like for the dive scene to save bumblebee, she should've had a stun gun or something that she probably got when getting ready to go out and save bee, and when she dove in to get him, she should've activated the stun gun to his chest, reactivating him but giving her a nasty shock, so it'll knock her out, and then the awakened bumblebee will grab her, bring her up to the surface, where John Cena will do CPR.

  • @ghost_pl9259
    @ghost_pl9259 Před 5 lety +113

    I think a better title would be "How lack of plot killed a movie". Focus on character does not always exclude plot.

    • @ghost_pl9259
      @ghost_pl9259 Před 5 lety +7

      @Adrijana Radosevic Did you even watch the video? Plot and story shouldnt be considered the same thing.

    • @enderziom04
      @enderziom04 Před 5 lety

      'Almost'

    • @SaintsBro217
      @SaintsBro217 Před 5 lety +17

      The plot is pretty straightforward. Bee lands on earth, loses his memories and meets Charlie. Together they rediscover his past and save the world from the Decepticons. It's not Shakespeare or anything and it's rather silly to expect complex plots from a story like this.

    • @Michael_ORourke
      @Michael_ORourke Před 5 lety +9

      @@SaintsBro217 The movie has a plot but the two main characters aren't a part of it until the end, Bumblebee and Charlie have no goals until the very end when the Deceptions find Bumblebee. The subplot of the Deceptions coming to earth to find Bumblebee, then befriending the US government and getting their aid was actually more interesting because they had a clear goal. Like the video said, if Bumblebee/Charlie's goal had been to find/fix his voicebox then it would have made the movie more engaging. Characters hanging out and doing random things does not make an interesting movie.

    • @SaintsBro217
      @SaintsBro217 Před 5 lety +8

      @@Michael_ORourke
      Their goals are also straightforward. Bee wants to make Charlie happy and Charlie wants to help Bee hide while they find out where he came from. I don't know why everyone seems to be missing this.

  • @darrylaz3570
    @darrylaz3570 Před 5 lety +229

    Sorry, Filmento, I do not agree at all. The reason Bumblebee kinda flopped is because the competition. It was pitted against Aquaman and Mary Poppins Returns, both have already got huge box office results. Pitted against them both is literal suicide.

    • @captainobvious90
      @captainobvious90 Před 5 lety +21

      The flaws he pointed out are valid, but doesn't necessarily affect the low turn out. Your reasoning is made much more sense imo.

    • @UltimateKyuubiFox
      @UltimateKyuubiFox Před 5 lety +28

      TheWorkingMachine Aquaman made more money than God that December. Their argument isn’t stupid, it’s substantiated. Aquaman was a massive blockbuster action-fest where Bumblebee is a smaller-scale movie from a franchise that had burned people before.

    • @TFanPage101
      @TFanPage101 Před 5 lety +29

      Not to mention, Spider-Verse.

    • @cyanrex1074
      @cyanrex1074 Před 5 lety +6

      TFanPage101 Yeah it’s really a surprise bumblebee made enough money in general. It’s like when they put solo against infinity war and Deadpool 2 even if fans didn’t want to go see it, it probably would have failed

    • @16bitworld2
      @16bitworld2 Před 5 lety +4

      Not only that, but Bumblebee is a solid character yes but he is not popular enough to draw a huge crowd

  • @chinmayasinghrawat4622
    @chinmayasinghrawat4622 Před 3 lety +3

    I remembered about this movie out of the blue, and wanted to know Filmento's thoughts on it - and this video is spot on!
    I actually liked the idea of a clichéd teenager-with-issues character in a Transformers universe, and was interested to see the direction that they were going for, yet it just felt like something was missing.
    Credit where it's due, I actually liked the character driven, grounded approach they had taken with this one, rather than another doomsday like event film with the entire world at danger.

  • @ArchiveInContext
    @ArchiveInContext Před 11 měsíci +2

    All they had to do was make it so that shatter and dropkick were going to do somthing really bad on earth and bee had to stop them

  • @midnightstorm4290
    @midnightstorm4290 Před 5 lety +1793

    Bumblebee was actually a really good movie tbh

  • @RowZilla42
    @RowZilla42 Před 3 lety +40

    actually no bumblebees a Child Soldier most versions of him he's born during the war

  • @TerminatorTheory
    @TerminatorTheory Před rokem +3

    *I feel like the box office of Bumblebee consisted exclusively to GeeWunners (diehard G1 fans) and will never be as big as the Bayverse. Hasbro focuses on fans when Paramount knew Bay was the powerhouse of entertainment. I never seen a non-g1 fan shit on the Bayverse.*

  • @timothyt.82
    @timothyt.82 Před 3 lety +12

    Plot idea: Charlie feels obligated to help fix bumblebee because she has already repaired him this far (waking him up). Through this journey to fix him, they grow a close relationship and learn how to be an effective team. The bad guys show up about halfway through the movie, and put this newfound friendship to the test, all the meanwhile providing a means to achieve the goal of fixing Bumblebee. Eventually, in the third act, Bumblebee is fixed and the final showdown happens, and while he still cannot speak, he is back to his old self and thanks Charlie for being a bro.
    Why do they do the cliff scene? Because Bumblebee saw a chance to help his friend do things.
    Why does Bumblebee stick his finger in the socket? Does he even know what a socket is? For all he knows, it's a decorative piece or some sort of data port.
    Why does Charlie be the sad? Because she do.

  • @LuisLopez-ub4pp
    @LuisLopez-ub4pp Před 5 lety +405

    Bumblebee makes the quality all the latest Bayformers movies. And I felt the first time that a film based on the transformers I really got pleasure and no irritation!
    Bumblebee workes because the Director of this film takes care of the "Character" and his development, not the explosions, action and sea of toilet humor. (Take in example the same scene, where Bumblebee simply pissing on agent Simons)

    • @Commander_Shepard.
      @Commander_Shepard. Před 5 lety +3

      Still unironically funnier than any scene that had Charlie's family. Especially that annoying little brother. Urggghhhh

    • @XepptizZ
      @XepptizZ Před 5 lety +7

      Yeah, it had character, but noactual developement. Shit just "gets resolved" for no real reason. Suddenly the family is fine and suddenly bums and charls have to split. She was also a useless character through and through. Only near the end was she useful. And saving someone through the power of love doesn't count, that's the cheapest plot device ever invented by anime.

    • @Commander_Shepard.
      @Commander_Shepard. Před 5 lety +13

      @@XepptizZ I know I'm gonna get lot of shit for this but Sam had more development is first movie than Charly did in "character-focused" Bumblebee movie.

    • @MrAsh1100
      @MrAsh1100 Před 5 lety +1

      @@XepptizZ Hey hey, Anime didn't invent that kind of power plot! Anime told love to kill itself......oh dear....

    • @XepptizZ
      @XepptizZ Před 5 lety +7

      @@Commander_Shepard. Development? The only development is from the army guy, he gets called to action by nearly dying, because of aliens. Gets blinded by hatred. Double whammy when his suspicions get confirmed by the decepticons deceit. Than reconciles with bumblebee after seeing the truth. That is more character development than all the other characters from the movie combined.

  • @lordofgriddlecakes5686
    @lordofgriddlecakes5686 Před 10 měsíci +1

    I'm not well-versed in the Transformers universe. But an idea for the plot could have been Bumblebee running from his new responsibilities as a soldier and a protector of earth. By encountering humans and protecting them from danger, he matures and realizes that he was made for helping the people of earth (he was born to protect). The human he is with may also be running from something, and they both come to terms with their new lives in a relatable way.

  • @lilcrantree2189
    @lilcrantree2189 Před rokem +1

    I think the main problem is people thought it was a prequel even though its a reboot. People thought they didn't need to see it to get the story. They really should've made it more clear that its a reboot and they should've kicked that one producer off the set.

  • @MarkyMatey
    @MarkyMatey Před 5 lety +54

    There are plenty of movies that aren't ordained by plot, but by characters.
    I found it refreshing that a blockbuster is less occupied by plot and more with characters.

    • @adrianbundy3249
      @adrianbundy3249 Před 5 lety +7

      Even those movies mostly focusing on characters still have plots. The good ones anyway.
      There are two types of writing though, both with good and bad examples: Stories where plots drive the characters, and stories where characters drive the plot. A generic movie like Independence Day is a good example of the former, and Game of Thrones, at least early on - had great examples of the latter. But make no mistake, there was still deep plot threads. Good cinema almost always has to have plot.

    • @android19willpwn
      @android19willpwn Před 5 lety +2

      it's fine to have something more focused on characters than plot, but focusing exclusively on characters will cause many people to lose engagement at one point or another, as the runtime stretches on without a feeling of progression to keep them invested. I'm not saying you can't do that and have it be good, but as he said that's the plot of a low-budget indie film. It's not going to be as engaging for a super wide audience and it's extremely difficult to market to that wide audience, so it's difficult for such a film to make summer block-buster levels of money. And that's a problem when you're pouring summer block-buster levels of budget into special effects and marketing.

    • @Michael_ORourke
      @Michael_ORourke Před 5 lety

      Character's actions should drive a plot forward. The main character's actions in Bumblebee do not drive the plot forward, therefore creating a feeling of stagnation while watching the movie. I felt slightly bored watching this movie and had a hard time figuring out why until I saw this video. I have no problem watching a slow moving character drama as long as character's actions cause things to happen in the story, otherwise the characters end up not being interesting. Charlie was set up as an interesting character but she doesn't do anything interesting in the movie.

    • @johnnyskinwalker4095
      @johnnyskinwalker4095 Před 5 lety

      well you have to have an interesting story. which it didn't have

    • @ReaperBlaze76
      @ReaperBlaze76 Před 5 lety

      @@Michael_ORourke Charlie starting up Bee is literally what makes the Decipticons come to earth.

  • @eomersimbajon2938
    @eomersimbajon2938 Před 5 lety +271

    bruh, you just literally said he lost his memories. thats literally the reason why Bee is being like a child. A CURIOUS CHILD. he literally has no idea NOR DOES HE EVEN KNOW, what are the things around him.

    • @k.s.2935
      @k.s.2935 Před 5 lety +70

      Depends on the type of memory loss. Usually people don't revert and become infantile when they lose memory. That was done in this movie to make Bumblebee "cute" and appeal to family movie audiences. Otherwise, Bumblebee has more issues than being the lamest Transformer.

    • @hthrun
      @hthrun Před 5 lety +32

      @@k.s.2935 I also don't think they explained enough how his memory worked. It wasn't technically erased because it came back later on when Charlie shocked him. Why did it come back then and not when he stuck his finger in the socket? Where was all that data in the meantime, a back-up drive? If so, why didn't it get reloaded automatically? If it was due to damage, Charlie shocking him shouldn't have brought it back, unless there's some healing aspect involved. But the movie didn't explain any of that, it was just another thing that just happened out of convenience.

    • @Sichko021
      @Sichko021 Před 5 lety +7

      @@k.s.2935 Dude i will say only this... thank you for comment.

    • @catcatcatcatcatcatcatcatcatca
      @catcatcatcatcatcatcatcatcatca Před 5 lety +12

      Honestly there is no good explanation needed for bumblebee to act childisly. The problem with scene mentioned is that it's a lazy way to get detected.
      Bumblebee crushes cars and causes mayhem, but it only now matters? Audience will be cheated by that, as there is no coherent build-up. If anything, by the end bumblebee should cause less random mayhem, and be harder to detect. This is just another gag with no significant emotional loading. Important moments need already established emotional loading, a logical reason, or another significant aspect to work. Audiences don't complain about deus exmachinas unless they are both logically and emotionally unexpected.
      So I agree, this video misses the fault here. Bumblebee could act childlishly for any reason, and it wouldn't significantly worsen the movie. What matters that his actions and what follow from those actions is coherent.

    • @jeagerkej3171
      @jeagerkej3171 Před 5 lety +7

      Rygart Arrow no, he acted like a fucking moron for the sake of the plot, because the writers are too fucking lazy and shitty to figure out how to move the plot forward otherwise.

  • @ortega902
    @ortega902 Před 3 lety

    Thank u filmento u really help me a lot with all about writing and PLOT!!!

  • @forsho7123
    @forsho7123 Před 3 lety +2

    "With all due Respect, have you lost your damn mind!!"

  • @curtthegamer934
    @curtthegamer934 Před 5 lety +8

    A girl finds a stranded alien robot, and they work together to figure out the robot's mission. That's the plot.

  • @JaeTheGent
    @JaeTheGent Před 5 lety +85

    Crazy part, I'd totally watch a flick about the avengers just hanging out

    • @android19willpwn
      @android19willpwn Před 5 lety +19

      sure, but that's because The Avengers is riding off of a lot of character familiarity and series good will. Neither of which were luxuries that Bumblebee enjoyed.

    • @Michael_ORourke
      @Michael_ORourke Před 5 lety +5

      It'd be fun for about the first 10-15 minutes but it would get quickly boring without some kind of story.

    • @_V.Va_
      @_V.Va_ Před 5 lety

      Eating schwarma.

    • @goku21youtub
      @goku21youtub Před 5 lety

      *Mr. Jae Gentleman Extraordinaire* , wants to sound smart , sounds like a moron

  • @justincha4973
    @justincha4973 Před rokem +4

    Sam and Mikaela will always be the best human characters in the transformers franchise

  • @slu4aennepoznat216
    @slu4aennepoznat216 Před 3 lety +1

    I think the goal was to help Bumblebee understand this new world and eventually find his voice and get back his memories. I know not many people will agree but that's my opinion. Overall a great explanation, good job on the video!

  • @danielcervantes7826
    @danielcervantes7826 Před 5 lety +40

    A cybertronian soldier finds himself in an alien planet, and is under the orders to protect it

    • @zad_rasera
      @zad_rasera Před 4 lety +1

      Generic, lol.

    • @zad_rasera
      @zad_rasera Před 4 lety +14

      "Robot gets lost. Robot must protect Earth."
      Let's change that to
      "Robot with amnesia gets lost and suddenly gets attacked by bad guys. With the help of a human girl, the unlikely duo undergoes a journey to beat the bad guys and to get robot's memory back."
      There. It's intriguing, right?

    • @tosevitezhamrick
      @tosevitezhamrick Před 3 lety +2

      Micah Rhorer “I found a planet that's well hidden. Earth. You will travel there and establish a base for us. Once we've gathered the others, we'll join you.” -Optimus Prime. He’s basically telling Bumblebee to protect Earth, is he not?

    • @danielcervantes7826
      @danielcervantes7826 Před 3 lety +2

      @Micah Rhorer Prime literally says it in the speech, and yes its supposed to be generic and cheesy as many of the G1 jokes were

    • @oofoof6577
      @oofoof6577 Před 3 lety +1

      That is the worst plot I have ever heard. TLK has a better story then that. I'm not even kidding.

  • @hicknopunk
    @hicknopunk Před 5 lety +718

    I liked Bumblebee. Probably my favorite live action transformers movie.

  • @jetetarro
    @jetetarro Před 2 lety +1

    The loved this movie but the easiest way to point out there wasn’t a plot is that i can’t remember what the plot- the story- is about.

  • @The_Story_Of_Us
    @The_Story_Of_Us Před rokem +1

    I honestly think this movie’s “flop” was less to do with anything inherent, but the fact that the previous Transformers movie was so bafflingly appalling, a crime against humanity that at that point, even general audiences said no and didn’t turn up to the cinemas. They permanently lost some of their audience.
    Bumblebee: 102-135 million $ budget, 468 million box office
    Transformers The Last Knight: 217-260 million $ budget, 605 million box office.
    a 3.5 times return on initial investment versus a 2.3 times return on initial investment
    Bumblebee was actually a financial success compared to the last atrocity.
    So a suffering plot was less of a fatal flaw and more of a… flaw. As Filmento points out, something that hurts the movie’s box office returns more than it does the quality of the film.

  • @187SicknesS
    @187SicknesS Před 4 lety +153

    I watched this movie last night for the first time and was on the wall about it...but, there was one thing that made watching this movie worth it.
    SOUNDWAVE

    • @187SicknesS
      @187SicknesS Před 4 lety +4

      @Requiem Eye yeah, boomer cuz someone finally got Soundwave right in a transformers movie 😼

    • @GoodwillWright
      @GoodwillWright Před 3 lety +12

      When Soundwave invades Earth.
      "Duuuude, look at this trash. He can't even transform into a bluray player".
      Jokes aside, I always loved Soundwave. Not sure why, he was kinda the cool character. And Laserbeak, Ravage and the Rumblers were also pretty cool.

    • @austindemuynck9460
      @austindemuynck9460 Před 3 lety +3

      @@GoodwillWright next movie should have been a dance battle between Soundwave and Jazz.
      Shit would have been fire

    • @aetheriox463
      @aetheriox463 Před 2 lety

      @@austindemuynck9460 no no no they should bring back blaster and have a stand off between them like every time they fought in the cartoon. THAT would be fire

  • @BSJINTHEHOUSE420
    @BSJINTHEHOUSE420 Před 5 lety +154

    It flopped because people don’t like bees.

  • @TheManWhoLaughs2008
    @TheManWhoLaughs2008 Před 2 lety +3

    Bruh everything about Bumblebee was perfect, it redeemed the franchise after Bay screwed everything up, plus you could actually tell who the characters are

    • @kingslayerx1716
      @kingslayerx1716 Před 2 lety +1

      This comment makes no sense. Tell what scene in the bayverse where you can’t tell who the characters are

    • @TheManWhoLaughs2008
      @TheManWhoLaughs2008 Před 2 lety

      @@kingslayerx1716 nobody really knew who was who due to the complete crappy design changes like soundwave for example.

    • @kingslayerx1716
      @kingslayerx1716 Před 2 lety +1

      @@TheManWhoLaughs2008 soundwave literally has neon blue soundblasters on his arms, a giant Mercedes Benz logo on his chest, and laser beak on his fucking arm. You’d have to be blind to not be able to tell the difference lmao

    • @TheManWhoLaughs2008
      @TheManWhoLaughs2008 Před 2 lety

      @@kingslayerx1716 the Bayverse designs are far from accurate, they don’t even have the same personalities.

    • @kingslayerx1716
      @kingslayerx1716 Před 2 lety +1

      @@TheManWhoLaughs2008 it doesn’t have to be like g1 tho

  • @TheSilverwolf97
    @TheSilverwolf97 Před 11 měsíci +2

    I don't think the movie not having a plot is a problem, there are plenty like that. One that comes to mind right now is a Marriage Story, the movie is just life events on a timeline without a proper goal and it's an Oscar winning movie. Life itself doesn't have a plot, character studies are generally not about the plot. Although I'll give it to you that some scenes are kinda shoved in and not organic as this type of movie should be. Except the finger on socket, Bee was pretty much established as a big metal toddler from the start.

  • @RisingPhoenix05
    @RisingPhoenix05 Před 5 lety +15

    I feel like theres no plot because they tried to make this a tie in as a prequel, yet distance itself from Bayformers

  • @pradityapascalisprawito3153
    @pradityapascalisprawito3153 Před 4 lety +114

    Your perspective definitely opened my eyes to why the Bumblebee film didn't get that high of a rating, but personally Im just glad this aint no Micheal Bay Explosives demonstration :D

    • @sinpancho3089
      @sinpancho3089 Před 3 lety +29

      Well, the best rated Transformers films are the first one, and this one. They both have a rating of 7.1, according to IMDB. The others are kinda just there. Personally, I really enjoyed the third one, which was Dark of the Moon.

    • @kingslayerx1716
      @kingslayerx1716 Před 3 lety +2

      @@sinpancho3089 same

    • @etam8099
      @etam8099 Před 2 lety

      @@sinpancho3089 3 and 4 for me

  • @logger22
    @logger22 Před rokem +8

    I think a large factor of why Transformers movies are controversial are because of the diverse and toxic fanbase. They all want a live action Transformers to be shown into a certain image. Every time they get original designs, they complain that the G1 based designs look cartoony and unrealistic. They complain Optimus acts like a psychopath but say that he’s a badass murdering Decepticons with extreme prejudice. Transformers fans ask for innovation but every time they get it, they hate it. They don’t know what they want.

    • @davisdf3064
      @davisdf3064 Před rokem

      I am a Transformers fan, and i got all that from Transformers Prime and Transformers Animated, i watched Bumblebee and thought it was pretty good.
      I just wish Holywood actually cared about the *Transformers* and made a movie for the war in Cybertron with Bumblebee's style.

  • @sulphurous2656
    @sulphurous2656 Před 3 lety +1

    I think the biggest problem this movie had is not having 'Transformers' in the title.