How Does COVID-19 Testing Actually Work?

Sdílet
Vložit
  • čas přidán 27. 06. 2024
  • Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it's done. We'll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody.
    Earlier videos:
    PCR - • Everything You Could W...
    Gel Electrophoresis - • Gel Electrophoresis: H...
    ___________________________________________________________________
    Try tab for a cause today:
    tab.gladly.io/thethoughtempor...
    ___________________________________________________________________
    00:00 - Introduction
    04:00 - Virus Anatomy Overview
    09:45 - PCR Overview
    13:30 - Performing PCR
    20:37 - Testing at Scale and Robots (Opentrons)
    23:30 - LAMP overview
    27:50 - Performing LAMP (Biofoundry)
    30:30 - Pros/Cons of Genetic Tests
    31:30 - Antibody Overview
    32:50 - Performing Antibody Test
    34:00 - How Antibody Tests Work
    38:00 - Summary
    ____________________________________________________________________
    Support the show and future projects:
    Patreon: / thethoughtemporium
    Nebula: go.nebula.tv/thethoughtemporium
    Ko-Fi: ko-fi.com/thoughtemporium
    Become a member: / @thethoughtemporium
    Store: thethoughtemporium.ca/
    ______________________________________________________
    Our Social Media Pages:
    Tiktok: / thethoughtemporium
    Instagram: / thethoughtemporium
    Facebook: / thethoughtemporium
    Twitter: / emporiumthought
    Website: thethoughtemporium.com/
    _____________________________________________________
    More resources, and citations:
    Kurzgesagt Covid Overview: • The Coronavirus Explai...
    A great writeup about the virus's anatomy: bit.ly/2FJq6G8
    JOGL: app.jogl.io/program/opencovid19
    Biofoundry: foundry.bio/
    Student Outbreak: bit.ly/2Qa3vEq
    Student Outbreak 2: bit.ly/34hQgdl
    Strokes In heathy people: bit.ly/2QdQREK
    Organ Damage: bit.ly/3aHONhy
    Aptamer Tests: rsc.li/3j2Fb3I
    Variations in Test Accuracy: bit.ly/2YlojNV
    Faulty probes: bit.ly/3aIPlDJ
    Contaminated Swabs: bit.ly/34fnVEt
    False positives FDA: bit.ly/3gojBFv
    E protein structure: bit.ly/3aN5Yyb
    MERS fact sheet: bit.ly/2CLUaQn
    Incidence of thromboembolism: bit.ly/2YgiBgc
    Stroke study: bit.ly/2E59Pei
    Stroke 2: bit.ly/2Yk8yql
    Cardiac infection: bit.ly/3l5DaWo
    Asymptomatic infection rate: bit.ly/2YgiOju
    Asymptomatic infection study: go.nature.com/2CLO2rb
    Organ damage in asymptomatic pateints: bit.ly/2YfaMHJ
    Wisconsin LAMP trial: bit.ly/3aIQfA7
    Healthy people stroke: bit.ly/2YmKEuB
    LAMP Assay design: bit.ly/3aJnqUv
    Mutation geneology: bit.ly/34hxqTs
    Cardiac outcomes: bit.ly/3hjJBmo
    False negative rate: bit.ly/3j47I95
    ACE2 distribution: go.nature.com/3aJsMyR
    Long Haulers article: bit.ly/2EgU9nP
    Long haulers Video: • COVID-19 Antibodies: W...
    Complete protein models: bit.ly/32akpIS
    Antibody test: bit.ly/2CIXT0S
    _________________________________________________________________________________
    Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: binomicalabs.org/
    SpikeF - AGGAATTTTTATGAACCACAAATCA
    MembraneR - CGGTGATCCAATTTATTCTGTAAAC
    NucleoF - AAATGAAAGATCTCAGTCCAAGATG
    NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT
    Original Primers:
    N1F - GACCCCAAAATCAGCGAAAT
    N2F - ttacaaacattggccgcaaa
    N3F - GGGAGCCTTGAATACACCAAAA
    N2R - GCGCGACATTCCGAAGAA
    N2-LF - gggggcaaattgtgcaatttg
    N2-B3 - gacttgatctttgaaatttggatct
    N2-F3 - accaggaactaatcagacaag
  • Věda a technologie

Komentáře • 1K

  • @thethoughtemporium
    @thethoughtemporium  Před 3 lety +516

    Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: binomicalabs.org/
    SpikeF - AGGAATTTTTATGAACCACAAATCA
    MembraneR - CGGTGATCCAATTTATTCTGTAAAC
    NucleoF - AAATGAAAGATCTCAGTCCAAGATG
    NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT

    • @sadface7457
      @sadface7457 Před 3 lety +4

      when is the next micro fluidic video ♡

    • @wolf359loki
      @wolf359loki Před 3 lety +1

      Can you link to the Antibody test you used?

    • @rougenaxela
      @rougenaxela Před 3 lety +18

      It's nifty taking those little primer sequences, doing the reverse complement, and putting it into a BLAST search, and seeing only SARS-CoV-2 come back in the results.

    • @Ahnahtan0
      @Ahnahtan0 Před 3 lety +1

      Very useful and informative! Valuable insight on this be-tweaked-st microbe toward its management.

    • @vitezhrabri4054
      @vitezhrabri4054 Před 3 lety

      Hi so my question is the is a math solution how to do any kind of testing more efficiently, so is it possible to mix 4 or more samples together so it triggers if only one of them is positive?

  • @Bigfoot_With_Internet_Access
    @Bigfoot_With_Internet_Access Před 3 lety +1418

    Luckily I've managed to avoid getting it so far by hiding out here in the deep forests

  • @alexandrelanhoso5538
    @alexandrelanhoso5538 Před 3 lety +734

    I love how he casually use peas as coolant for his biological raw materials.

    • @MudakTheMultiplier
      @MudakTheMultiplier Před 3 lety +66

      They're reusable!

    • @supernoodles908
      @supernoodles908 Před 3 lety +64

      @@MudakTheMultiplier and biodegradable

    • @spokehedz
      @spokehedz Před 3 lety +41

      @@supernoodles908 also great for when you bang your head on the fume hood...

    • @superdupergrover9857
      @superdupergrover9857 Před 3 lety +26

      There's also a pea shortage. No joke, the demand for peas from the fake burger industry has caused a shortage.

    • @superdupergrover9857
      @superdupergrover9857 Před 3 lety +13

      @@RoboticusMusic They can contaminate those vegan burgers all they want. Campbell's stopped production of their split pea soup (my favorite) because of the pea shortage.

  • @Ididathing
    @Ididathing Před 3 lety +1087

    i should have watched this video before i tried

  • @zuthalsoraniz6764
    @zuthalsoraniz6764 Před 3 lety +373

    Meow Ludo Disco Gamma Meow Meow has to be the most cyberpunk name I've heard, at least for a real-life person

    • @MemesnShet
      @MemesnShet Před 3 lety +6

      I’ve read the “Gamma” as Grandma at first lmao

    • @pineapplesareyummy6352
      @pineapplesareyummy6352 Před 3 lety +45

      I had to type that name into Google. That's his real name. He even ran for political office in Australia under the 'Science Party' and is a geneticist and entrepreneur. He is a serious guy with an unusual name.

    • @caca95cb
      @caca95cb Před 3 lety +7

      Dude he's totally related to Catra Applesauce Meow Meow from She-Ra

    • @Suninrags
      @Suninrags Před 3 lety +4

      @@pineapplesareyummy6352 did he change his name? I would assume he did

    • @waterunderthebridge7950
      @waterunderthebridge7950 Před 3 lety +13

      Neon Red kill Yup, apparently he made a funny name list with his friends and picked one he liked to change his name to

  • @DrakkarCalethiel
    @DrakkarCalethiel Před 3 lety +511

    PCR= Pipette, Cry, Repeat. Never change! 😂😂

    • @Queekusme
      @Queekusme Před 3 lety +25

      This needs to be a new T-shirt design

    • @DrakkarCalethiel
      @DrakkarCalethiel Před 3 lety +25

      @@Queekusme Hahaha, thus needs to happen!
      Shirt design on back:
      PCR
      Pipette (pipette logo)
      Cry 😭
      Repeat (uno reverse card)
      I would get one like this. :D

    • @thethoughtemporium
      @thethoughtemporium  Před 3 lety +115

      Already working on it. Will have it out soon

    • @justalapwing
      @justalapwing Před 3 lety +4

      I'd buy it

    • @MultiPss
      @MultiPss Před 3 lety +5

      @@thethoughtemporium I need it

  • @JustOneAsbesto
    @JustOneAsbesto Před 3 lety +239

    *L* (oop mediated isothermal) *AMP* (lification), I assume.

    • @GasparLewis
      @GasparLewis Před 3 lety +17

      Either that or another language, like "SI" for SI units.

    • @SquaredSmith
      @SquaredSmith Před 3 lety +10

      Nah it's that thing on your bedside table what shines light. It can detect the virus through... uhhh... science magic

    • @jrblast
      @jrblast Před 3 lety +9

      @@GasparLewis Or UTC where the English and French couldn't agree so they decided on an order that's wrong in both languages.

    • @EnriqueGonzalez-pw7xe
      @EnriqueGonzalez-pw7xe Před 3 lety +5

      Or maybe it just was developed by moths, who knows?

    • @grn1
      @grn1 Před 3 lety

      Just paused the video to comment this.

  • @Spit823
    @Spit823 Před 3 lety +59

    Im 26 and had covid. I had symptoms for about 16 days. It felt like a moderate cold but with severe soreness and pain in my joints, especially my legs. I have moderate asthma and my breathing was easily controlled with my inhaler. I’m also a microbiologist so this whole pandemic has been extremely interesting. This is a great video.

  • @desmond-hawkins
    @desmond-hawkins Před 3 lety +11

    Meow-Ludo Disco Gamma Meow-Meow is such an amazing name. Looking him up, I learned that he got in trouble for implanting his public transport card chip into his hand and was fined and summoned to court for traveling without a valid ticket (the judge dropped the case). Sounds like an interesting friend :-)

  • @marcinzdunek2902
    @marcinzdunek2902 Před 3 lety +234

    Anybody knows similiar channels about biology and chemistry? I only know this, and Nilered, and these topics are really interesting

    • @soumyadipbiswas9074
      @soumyadipbiswas9074 Před 3 lety +31

      NielBlue

    • @soroushmirghasemi623
      @soroushmirghasemi623 Před 3 lety +31

      Marcin Zdunek I’m more familiar with chemistry channels, there are channels like explosion & fire, nerdrage, nighthawk in light, if you are interested in lasers styropyro has some great content and does some chemistry at times as well, of and applied science does great stuff too.

    • @polymorphicprocrastination5345
      @polymorphicprocrastination5345 Před 3 lety +51

      @@soumyadipbiswas9074 Applied Science

    • @notmynameanymore941
      @notmynameanymore941 Před 3 lety +15

      ElementalMaker is a dude who does a lil bit of everything, from artificial rubies to sugar rocket builds, plus he is a pretty funny dude; reminds me of a pipeline worker but smarter /s

    • @domokospiller8306
      @domokospiller8306 Před 3 lety +13

      Explosion & Fire

  • @ernestkirstein6233
    @ernestkirstein6233 Před 3 lety +104

    Great video but I kind of laughed at the end. Putting a "listen to the scientist" spiel at the end of a 40 minute technical video on covid testing is the definition of preaching to the choir.

    • @KnakuanaRka
      @KnakuanaRka Před 3 lety +3

      Yeah, the sorts of people who would need to learn that aren’t going to watch a video like this.

    • @drkastenbrot
      @drkastenbrot Před 2 lety +1

      @@KnakuanaRka They definitely watch videos like this, skipping through it to find bits that support their narrative and pull them out of context. Too bad this video doesnt say anything easily pulled out of context.

    • @KnakuanaRka
      @KnakuanaRka Před 2 lety +1

      @@drkastenbrot Wish more videos could be like this one in that way.

  • @StormBurnX
    @StormBurnX Před 3 lety +21

    it is INSANE how far you have come from the first videos I saw (the radio telescope/"wifi camera" adventures). the quality of science, recording, narrating, and overall production has jumped vastly; the scale and capability of your lap and tools have expanded as well; and perhaps most importantly, your passion for science and earnest pursuit of spreading knowledge has never yielded.
    Keep up the good work, keep yourself safe, and don't forget to take breaks sometimes so you don't burn yourself out!

  • @jpjude68
    @jpjude68 Před 3 lety +46

    15:03 Ah yes, the most used refrigerant agent in biolabs : frozen peas! :D

  • @charles8072
    @charles8072 Před 2 lety +4

    as a scientist like yourself, do you ever question the origins of COVID? do you think that there is anything you find uncertain or questionable about the virus?

  • @MoritzvonSchweinitz
    @MoritzvonSchweinitz Před 3 lety +33

    at about 31:00 you state that people with past infections don't PCR test positive - actually, a surprising amount of people test positive weeks after a passed infection, due to "genetic garbage" still hanging around. These patients are, according to WHO standards, not considered infectious patients anymore.
    Do you know what this "genetic garbage" actually is? How long can naked pieces of RNA just hang out on mucous membranes?

    • @selkywaters
      @selkywaters Před 3 lety +16

      I know a guy that kept testing positive over and over. Finally somebody told him to rinse his sinuses out with saline. He did it three times a day for 8 days and finally tested negative.

    • @gabrielcohen1538
      @gabrielcohen1538 Před 3 lety +3

      I thought such garbage was automatically kind of broken down but maybe it only applies to waste products from the cell and not from outside

    • @CodingCorvus
      @CodingCorvus Před 3 lety +3

      RNA is officially a proteïne so it can take a long time for it to break down under the temp it was meant to be in. (sorry i dont have a concrete number)

    • @Spree1775
      @Spree1775 Před 3 lety

      @@CodingCorvus RNA RUBBISH..as a Physicist it's obsolete rubbish.

  • @ryanc473
    @ryanc473 Před 2 lety +5

    And who knew, almost two years later and, well, we're still dealing with this crap. At least we've got some legit treatments now (you know, with actual scientific evidence in support of them) and a few vaccines. Though, despite getting the initial course and the first booster shot, I just recently got Covid myself (for anyone wondering, 0/10, would not recommend). I'm fine now, but it still sucked for about a week. And before you ask, I'm only in my 20s. Though, I at least don't seem to have any long term effects from it...one of my coworkers that got it really early on, relatively speaking at least (I believe it was in about November 2020) and she still can't smell or taste stuff. Which, I couldn't even imagine going through life like that.
    Edit: Oh yeah, and even still, +1 on the wear a mask part from a healthcare professional here (I work in a hospital lab). They really can make a difference. Although, I'll also say that while the cleaning EVERYTHING before bringing it into your house was solid advice at the time this video went out, turns out, SARS-CoV-2 doesn't spread that great on surfaces, so that isn't as necessary as originally thought. Still not bad advice in general, just not a major factor in terms of Covid-19 spread.
    Edit 2: oh yeah, and another thing, that is only relevant now that it's been a while since the video came out...The false negatives are far less common nowadays. They absolutely were a huge issue early on (i.e. back when the video was posted), but nowadays the tests are quite reliable, even for the newer variants.
    Edit 3: Just one more thing I wanted to add regarding PCRs...if you've never been around a hospital lab style PCR, the thing I think that'll stick out the most is they are loud. Like, really, really loud. At least, the ones we use are absurdly loud. It's reminiscent of what a jet engine sounds like from inside the plane. So not loud enough to require earplugs, but loud enough that it's very clear something is happening. Of course, the PCRs at the hospital are more than just the block that heats and cools to specific temperatures. I mean, yeah, it has that part, but it also does all the measurements and detection internally. No gel electrophoresis or additional manipulation of the sample. It's literally just mix the UTM from the swab with the reagents, load, and await results. So it's possible the PCR like described in the video isn't quite as noisy, but I'm far from an expert on the stuff lol.
    Oh, nice, he talks about the difference in the diagnostic PCRs vs the one he initially described. Should've just kept watching
    Edit 4: and now I suddenly know why some samples we've tested consistently come out with an "inconclusive" result. None of us were quite sure the reason behind it, and after watching the video, well, I still don't know the underlying mechanism but at least I know the problem. One of the two primers came up positive, the other negative (and the human gene control part worked). Thus, the machine would've given an inconclusive result, despite multiple tests on the same sample. We always just give up and ask the nurse to recollect after it comes up inconclusive twice, and 999/1000 that solves the problem. So I still couldn't say why the initial sample was problematic, but at least I know the reason the machine insisted on giving a result of inconclusive.

  • @DrmedWurst-se8df
    @DrmedWurst-se8df Před 3 lety +36

    As a healthcare professional I enjoyed your brief but scientific comprehension very much, to say it clear I love Your video! Thank you very much. (Of course I recommended it to many nerdy friends!)
    But I've been a bit suspicious with the Immunglobulines: As far as I know IgA (which is not present in your diagrams) is the only dimer (in humans), and IgD, which you present as a dimer is a monomer like IgE and IgG, too. Correct me if I am wrong!

    • @thethoughtemporium
      @thethoughtemporium  Před 3 lety +19

      You're correct, that was my mistake. Good catch! That was meant to be IgA. Must've gotten it confused in my notes at some point

    • @Spree1775
      @Spree1775 Před 3 lety +3

      @@thethoughtemporium I appreciate your integrity

  • @Ryan6.022
    @Ryan6.022 Před 3 lety +38

    Okay if Meow's parents named him that just imagine the bullying he went through.

    • @thethoughtemporium
      @thethoughtemporium  Před 3 lety +63

      He named himself that later in life.

    • @Ryan6.022
      @Ryan6.022 Před 3 lety +29

      @@thethoughtemporium then he is super awesome

    • @nefariousyawn
      @nefariousyawn Před 3 lety +13

      @@Ryan6.022 I'm imagining a hyper intelligent grad student that went on a psychedelic vision quest of a lifetime. From this he gained a sense of humor, a sense of purpose, and superhuman powers of chill. I've had friends attempt to rename themselves after a heavy trip, and none of them were this cool.

    • @nahometesfay1112
      @nahometesfay1112 Před 3 lety +6

      @@thethoughtemporium Is his first name Meow and his last name Meow Meow? Does his name follow the first, middle, last form?

    • @davidmaisel8062
      @davidmaisel8062 Před 3 lety

      @@thethoughtemporium He just got more awesome!

  • @jamisonturner9284
    @jamisonturner9284 Před 3 lety +1

    It makes me happy to know that there’s 80,000 other people out there who are actually interested in how things in the world work

    • @studioreep7449
      @studioreep7449 Před 3 lety

      And then there are THOSE dumbasses

    • @sababugs1125
      @sababugs1125 Před 3 lety

      @@studioreep7449 dumbases ?
      Dude calling them dumb is an insult to actually dumb people . You're giving those people way too much credit

  • @haydennorris2913
    @haydennorris2913 Před 3 lety +146

    I clicked as soon as I saw the patreon notification. Fantastic job on the animations. I can tell you really put your blood sweat and tears into this project. (sometimes literally) I also really appreciate that you didn't pull any punches for anti-maskers and conspiracy theorists. It's a bummer bad primers caused you so much trouble but I think the final product is some of your best work. I'm pretty hyped for the upcoming spider silk video. Keep up the good work Justin!

  • @gizmop0ny
    @gizmop0ny Před 3 lety +33

    "Build a neat and better mask"
    *becomes daftpunk*

  • @flopilop3808
    @flopilop3808 Před 3 lety +20

    I love the frozen peas used as cooling agent :DDD

  • @TerrierWhisperer
    @TerrierWhisperer Před 3 lety +16

    People are so caught up with deaths that they don't consider what happens to the survivors after - no matter if the illness was severe or mild.
    I had a 'mild' case, and I still have abdominal discomfort, occasional shortness of breath, and fatigue. Symptoms started on july 14

    • @thethoughtemporium
      @thethoughtemporium  Před 3 lety +12

      I mention this near the end

    • @socialamoeba6455
      @socialamoeba6455 Před 3 lety +7

      @@savage101. Good for you, sadly that is not the case for many.

    • @RBuckminsterFuller
      @RBuckminsterFuller Před 3 lety +3

      "Long-haulers" aren't unique to covid. A lot of people who are diagnosed with CFS/FM (chronic fatigue syndrome, fibromyalgia) likely started out with infections.

  • @covodex516
    @covodex516 Před 3 lety +9

    21:25 the googly eyes make your results more accurate.

  • @ScotlandTheBrave_1
    @ScotlandTheBrave_1 Před 3 lety +5

    I’m not sure if I’m taking your final point the wrong way but I thought it was quite controversial. Yes this is a temporary “new normal” and it kind of is a new normal in the sense that once we get over this virus we will react like Asian populations have done for decades aka wear a mask if you are sick. I’m not sure if you were implying that you’ll have to wear a mask for the rest of our lives, constantly? Correct me if I’m wrong on that one. We will get back to normal without the constant need to wear masks. We will socialise in bars pubs and clubs again. We will go on holiday again. All without social distancing and masks. It should be a selective thing. We need to encounter disease for our bodies to protect against them (I won’t patronise you because you’re well qualified for this OBVIOUSLY🤣). Masks won’t be weird anymore, people will wear them when they deem fit (after this pandemic) and people will be more open minded about wearing them. I think the problem with this virus was the initial uptake of masks either because they felt embarrassed or they thought it was stupid which is a valid reason because yes it is weird, but now it’s a whole new kettle of Fish people will have a much much faster reaction to future pandemics (if that’s what you mean by new normal). We can’t and won’t constantly wear masks after this virus has been contained and defeated, it’s just not socially viable, we are very social species and masks hinder our ability to connect with people. I’ve not been outside in weeks and I’ve only been outside 5 times in the past 3 months and that’s terrible because I’m feeling a little depressed. I’m doing my chemistry lectures from my bed and I’d say I easily spend 23.5 hours in bed which is utterly dreadful. At the start of the pandemic I’d go on 125km cycles twice a week for about 6 months going 25km walks but now I’ve been broken I guess. I’m in the Royal Air Force and I’ve have not flown in 11 months I’ve missed hundreds of hours of flying and activities I’m so sad. What I’m trying to say is we cannot and will not continue living like this and we will go back to a full normal with added reactions. This is all about gaining a valid reaction to this so we are prepared in the future, whether that’s from governmental spending in science, social norms in the sense of masks and social distancing, we will be more prepared for future iterations of this generation killer.

  • @sambrandner
    @sambrandner Před 3 lety +29

    Actually kind of blown away that you just exploit the RNAs goal to self replicate but do it in a lab and look for the result that it’s duplicated exponentially 🤯

    • @wesleymays1931
      @wesleymays1931 Před 3 lety +2

      This is called "tricking the enemy"

    • @masonbarber871
      @masonbarber871 Před 3 lety +2

      @@wesleymays1931 So I guess we are testing for covid by tricking, backstabbing, and quite possibly bamboozling a virus. I love science.

  • @nucspartan321
    @nucspartan321 Před 3 lety +2

    great video, enough over my head to make me realize how complicated it all really is

  • @bdnugget
    @bdnugget Před 3 lety +18

    Wow, I've used TLC a lot at the medicinal chemistry lab to monitor chemical reactions. Those anti-body tests are like ultra overdrive TLC, it's awesome

  • @coronal2207
    @coronal2207 Před 3 lety +79

    "We live in a cyberpunk dystopia" Video liked.

    • @moncza1866
      @moncza1866 Před 2 lety

      I can't find it but I want to

  • @8b8b8b
    @8b8b8b Před 3 lety +3

    Instead of disliking the video, read the citation in the description and check the sources, and then compare that to the citation of sources that says otherwise, if said citation exists at all

    • @XavierXonora
      @XavierXonora Před 3 lety +2

      You can't expect people to do work to debunk their own fallacies. It's a psychological disease

  • @firstlast446
    @firstlast446 Před 3 lety +170

    "I hope this will be enough of a wakeup call"
    haha, god I wish.

    • @StormBurnX
      @StormBurnX Před 3 lety +10

      the people watching these kinds of videos mostly are the people who already know it's bad. if there was a way to force this video's knowledge on everyone and force them to have a high enough IQ to comprehend it, then that would be a wakeup call.
      But no, the only brainwashing technology we have is 5G and coronavir- wait...

    • @LimabeanStudios
      @LimabeanStudios Před 3 lety +6

      Yeah at this point everyone has already formed their opinions on this whole situation, and that usually only changes when someone who downplays covid loses a family member.

    • @Herr_Brechmann
      @Herr_Brechmann Před 3 lety

      @@StormBurnX The whole world is dying, ffs you guys

    • @eideticex
      @eideticex Před 3 lety +4

      From what I have seen, I doubt the wakeup call will work either. I have seen plenty of people say "it'll all be over after the election" or similarly stupid nonsensical bullshit. All while having a friend or family member disappear to their home for a few weeks with COVID-19. They literally do not see or hear it happening right in front of them.

    • @TheComputadude
      @TheComputadude Před 3 lety +2

      @@eideticex And you also have people like Herman Cain who die from it and tweet from the grave about how it wasn't that bad.

  • @Nincadas1
    @Nincadas1 Před 3 lety +7

    Why are there so many dislikes wtf

  • @Tok_Janne
    @Tok_Janne Před 3 lety +8

    You can use aquarium gravel instead of frozen peas! Can even use it to flash freeze stuff if you have access to a -80°C freezer.
    Keep up the good work! Your videos are interesting to watch even for us who work in labs all day long.

    • @CodingCorvus
      @CodingCorvus Před 3 lety

      aqua-rium gra-vel, okay noted, anything else? (to flash freeze throw some liquid nitrogen over it)

    • @ayatotakema1194
      @ayatotakema1194 Před 2 lety

      im guessing it has a higher energy desity right?

  • @kurtnelle
    @kurtnelle Před 3 lety +5

    I can't believe I sat through this looong video about a field of science that I knew nothing about and actually learned something. This is some high-quality content.

  • @claudiog.7397
    @claudiog.7397 Před 3 lety

    Great vid and great link collection in the description. Thank you.

  • @PowerhouseCell
    @PowerhouseCell Před 3 lety +10

    This is a really detailed and amazing video! This information is important for the public to know, and I'm glad you're putting it out there. I hope my videos become as well-explained as yours one day haha :D

    • @CodingCorvus
      @CodingCorvus Před 3 lety

      with hard work and dedication you will one day.

  • @jaxsonsorenson3659
    @jaxsonsorenson3659 Před 2 lety +5

    It's really funny watching this video after all the stuff came out from the CDC.

    • @AnalogDude_
      @AnalogDude_ Před 2 lety +2

      he watched to much t.v.

    • @WarningStrangerDanger
      @WarningStrangerDanger Před rokem +3

      Specifically the masks bit. Masks were not very effective. 6 feet was an arbitrary decision. Totally avoiding people was the safest option.

    • @jaxsonsorenson3659
      @jaxsonsorenson3659 Před rokem +1

      @@WarningStrangerDanger Yes, 100%, but also the actual virus for everyone who isn't the age of 60 or has severe immune compromises, it has a 99.9% survival rate.

  • @ericaburke2366
    @ericaburke2366 Před 3 lety +12

    Where I live, we’ve only had 27 cases (all recovered with no deaths nor community spread) and it’s been almost two months without a case. Hearing about what’s happening in the rest of the world seems fake, though I know that it is, unfortunately, true. All we did was follow our public health guidelines. ITS NOT THAT HARD!

    • @hammerth1421
      @hammerth1421 Před 3 lety +1

      My county has 15 imported cases (that were detected) through people returning from their holidays. School starts again next week. This is gonna be great.

  • @mystwalker479
    @mystwalker479 Před 3 lety

    This dude's content is like the answer to my questions

  • @princesscheeseburger5198
    @princesscheeseburger5198 Před 3 měsíci +3

    Back when the death toll was only 700k 😢

  • @tateranus4365
    @tateranus4365 Před 3 lety +3

    The term Coronavirus comes from Spanish, corona is crown in Spanish, now does that crown on a bottle of corona beer make sense.

  • @DeathProductions200
    @DeathProductions200 Před 3 lety +6

    "each tan you open gives you a heart" oh no. I can get like 600 hearts a day just from forgetting how to spell

  • @bmw61j60
    @bmw61j60 Před 3 lety +5

    I think it's interesting that at the beginning of your video you basically say that no political talk should be made in the comments, then you go on to make a lot of political statements for 5 minutes at the end of your video.
    That being said, it's a great video, but I lost the ability to use this in my classroom when you went on a political rant at the end.
    I love your videos, and I hope you'll make one about T-Cell immunity because it gets old explaining it to people who don't understand even the most basic parts of biology. Keep up the good work!

    • @WarningStrangerDanger
      @WarningStrangerDanger Před rokem +1

      It is simply outdated at this point. The downside to such long videos is that you can't select for the information that withstood the test of time and set aside the parts that aged poorly.

  • @RabbeSandelin
    @RabbeSandelin Před 3 lety +3

    I have been looking for something like this for a long time, thanks. The only thing I disliked was the ”Don't be alarmed. But be alarmed, this is the new normal”-bit. In Finland we have a lot of new cases now, but zero people in intensive care for a month, and a just handful getting hospital treatment, even as very few bother with the masks. Is this because hand washing, distancing and protection of risk groups have been effective, or has something happened to the virus itself during summer? It is mutating, after all. I think the jury is still out on near future developments.

  • @BillEngwall
    @BillEngwall Před 3 lety +2

  • @serkanergun0
    @serkanergun0 Před 3 lety +32

    Isnt it Loop mediated isothermal AMPlication?

  • @matthewsidaway1437
    @matthewsidaway1437 Před 2 lety +2

    so interesting I've watched it twice - good job

  • @Danspy501st
    @Danspy501st Před 2 lety +1

    "It is like strapping a Corvette engine on your lawn mower"
    I might not be dumb, but I might be dumb enough to try that for shits and giggles XD

  • @SenorRu
    @SenorRu Před 3 lety +13

    I hate how the most common anti-mask argument is "It gives people a false sense of security and they stop social distancing". Because simply educating people is too hard.

  • @caelaise
    @caelaise Před rokem +6

    man it is depressing to know that we used to think there was a chance wed do something about all this instead of just arbitrarily deciding it was over when it wasnt and refusing to do anything more

  • @lizaeves9920
    @lizaeves9920 Před 3 lety

    I am currently a high school student and my school district decided from the start to not open up the schools in that district. This does suck as there is a major social aspect to school, but I`m becoming more grateful to the fact that they kept it to online school from the start as all of the other districts in the area are closing schools and are vastly underprepared for online school.

  • @edgeeffect
    @edgeeffect Před 3 lety +1

    I've been waiting for THIS VIDEO since the damn-penic started! Thanks!

  • @alexbombbird353
    @alexbombbird353 Před 3 lety +80

    How is there almost a 7:1 like to dislike ratio on this video? You would think the people subscribed to this channel would be the sort to know better than to subscribe to baseless conspiracies. Not to mention you clearly spent a lot of time thoroughly researching this and cited sources that they could check and see are reputable.

    • @Basement-Science
      @Basement-Science Před 3 lety +17

      Probably because a lot of CovIdiots get it recommended who are not subscribers.

    • @C2H5OHist
      @C2H5OHist Před 3 lety +40

      I disliked because I don't like politics in my scientific entertainment

    • @microwave221
      @microwave221 Před 3 lety +7

      People are eternally disappointing, and the number of comments alleging that the whole thing is a hoax should explain where it's all coming from. A vocal minority, but thankfully a minority none the less

    • @narpassword3546
      @narpassword3546 Před 3 lety +11

      In this day, where the right are blatant anti-intellectuals who dismiss any science that they don't "agree" with, science is inherently political

    • @Yildun28
      @Yildun28 Před 3 lety +17

      @@C2H5OHist Same here. The political digs undermine the credibility of the video. If I can spot fallacious reasoning/data on things I am well informed about, it makes me question whether I can trust him on things I am not and came to the video to learn more.

  • @renegadethesandwing02050
    @renegadethesandwing02050 Před 3 lety +3

    “Meow Ludo Disco-Gamma Meow Meow” That is the best name in the world!

    • @Ispike73
      @Ispike73 Před 3 lety +1

      It's really not. He implores people to take this seriously but then references someone whose name is meow meow that works out of an apartment...

  • @crazystuffproduction
    @crazystuffproduction Před 3 lety

    I wish this was 2 hours long in a way, but very great info here. and good final points, Really agree with your summery

  • @C2H5OHist
    @C2H5OHist Před 3 lety

    Nice, watching this while waiting for my test results. Will share the result and the test type when I find out, likely on saturday.

  • @joeblow4035
    @joeblow4035 Před 3 lety +3

    at 32:08 : polyclonal antibodies are distinct antibodies and not one that binds to many epitopes.

  • @hikaru-hokkyokusei
    @hikaru-hokkyokusei Před 3 lety +13

    Lol, i am proud of myself that i made it till the end of the video. If our biology classes were like this, they'd be more interesting to attend.

    • @averagecornenjoyer6348
      @averagecornenjoyer6348 Před 3 lety +2

      hentai ousama

    • @xenonram
      @xenonram Před 3 lety

      If teachers could spend DAYS/weeks making a video about a single example of a single topic, that would be true, but then an undergrad degree would take about 2 decades to complete.

  • @justsomeperson5110
    @justsomeperson5110 Před 3 lety +1

    Awesomely informative! Thanks!

  • @rastakiwi3899
    @rastakiwi3899 Před 3 lety

    Your videos make me want to do what you do so much, even if I have only very basic understanding of what is going on. Thank you!
    Edit: What studies did you follow?

  • @anthea9697
    @anthea9697 Před 3 lety +15

    Hi Justin, I’ve been binging these videos since I found them. I’m very interested in this line of work but am a physics junior already, with plans for a masters in electrical engineering, so my time to branch into biology while in undergrad is limited. Do you have any suggestions on classes to take that would set me up well to combine engineering, physics, coding, and bio? Or suggestions on extracurriculars or diy stepping stones?
    Thanks to you I’m looking into a magnet implant, depending on my future specialization, this could be super useful.

    • @thethoughtemporium
      @thethoughtemporium  Před 3 lety +17

      The easiest way to get started is probably on your own, but there's nothing stopping you from taking an intro to bio or biochem class. Though fair warning, they'll bombard you with an enormous amount of information. But if you just want to learn on your own, crash course has a bunch of great series on the topic. I also suggest the book "the manga guide to molecular biology". It's cute, well written, and covers a ton of stuff. Beyond that, look at places like amino.bio, biobits or carolina biological and get yourself one of their fantastic kits. You'll get some hands experience and get to see how some of this stuff works for yourself

    • @alima9353
      @alima9353 Před 3 lety +1

      What a coincidence I’m studying molecular biology at university but maybe want to stem out into physics. Maybe biophysics? There are similarities between biology and physics which may be surprising like molecular motors.
      Anyway good luck with your journey !

    • @drkastenbrot
      @drkastenbrot Před 2 lety

      I am doing EE at a uni and biochemistry and whatever else interests me on my own terms. Doing any biology at uni is very, very harsh.

  • @kalechapo8291
    @kalechapo8291 Před 3 lety +5

    LAMP I would assume is them using the “L” from loop and the “AMP” from amplification but it is a far stretch lol

  • @georgelosasso3835
    @georgelosasso3835 Před 3 lety +1

    Hey where did you get that antibody test that you did in the video? I’m immune compromised and I do monthly igg replacement therapy, and I would be interested to test myself to see if any covid antibodies have worked their way into my igg infusions. I would want so self administer because then I could avoid labs and potential exposure.

  • @MayBugg1049
    @MayBugg1049 Před 2 lety +2

    And here we are 1 year later at 343 million confirmed cases and 5.58 million deaths... 😭

  • @arantes6
    @arantes6 Před 3 lety +14

    39:12 I was almost as impressed by the fact that the auto-subtitles transcribed "Cheeto von Gropensnatcher" correctly as by the quality of the video ^^

  • @michaelpapadopoulos6054
    @michaelpapadopoulos6054 Před 3 lety +8

    - "If you think this is bad ooohh weee are you in for a surprise as climate change ramps up".
    I know this vid is about the coronavirus but i think more people need to realise this. Climate change cannot be compared with little things such as a pandemic, a complete collapse of the economy and growing inequality. Everyone agrees that 2020 is going to be remembered as one of the most sucky years of modern history. What we need to understand as a species is that climate change is going to make it so that every year is like 2020 all the time but then it is going to keep getting worse. We are not killing the planet. We are just destroying the intricate balance on which our way of life is based.

  • @samira.8919
    @samira.8919 Před 3 lety

    Great video! Love your channel :)

  • @bap3227
    @bap3227 Před 3 lety

    this videos rlly amazing like the animations and info and stuff! _but how did i get from minecraft to covid testing_

  • @thenimbo2
    @thenimbo2 Před 3 lety +15

    Please be careful about recommending ubiquitous testing. At very low prevalence levels, (sub the "prevalence threshold" for the test), the precision (PPV) drops rapidly. In places like NYC, where the prevalence is 1% or less, a large majority of positives end up being false. Until tests get to ultra-high >99.9% specificity, the prevalence threshold, given their sensitivity, is >3%.

    • @ukaszMarianszki
      @ukaszMarianszki Před 3 lety +4

      Getting a false positive is way less of an issue than missing a case, because the worst that can happen to you in that case is getting isolated, which you should be doing anyway

    • @GigsVT
      @GigsVT Před 3 lety +4

      @@ukaszMarianszki pretending that isolation has no cost is ridiculous

  • @hika8298
    @hika8298 Před 3 lety +5

    this was a nice summary of what I needed to know and what is currently known

  • @eljijo23XD
    @eljijo23XD Před 3 lety

    ngl watching this video at 1 AM really feels like the online school kicking in

  • @arjunlagisetty
    @arjunlagisetty Před 3 lety

    Should have stuck to that bio chemistry classes in college. I surprisingly enjoyed this video

  • @combin8or
    @combin8or Před 3 lety +6

    Stellar video, Justin. Good humor, too.
    I’m going to have to watch it a couple more times and check out those papers.

  • @dallinlaw6785
    @dallinlaw6785 Před 3 lety +13

    Please change your thumbnails, it's really hard to tell the difference between streams and normal content.

  • @NabilBennaniKerrout
    @NabilBennaniKerrout Před 2 lety

    A year after this video, still fantastic

  • @vitormhenrique
    @vitormhenrique Před 3 lety +1

    Awesome work! Thanks!

  • @XxfishpastexX
    @XxfishpastexX Před 3 lety +40

    Mr Meow Meow seems like a pretty chill dude

  • @xadadax5014
    @xadadax5014 Před 3 lety +10

    Hum.. whats going on with the dislikes? Are bots auto-disliking covid related vídeos or something?

  • @gobzanuff5078
    @gobzanuff5078 Před 3 lety +2

    Ok gonna save this video... For night time sleep...
    (was watching during day... cause strong sleepiness)

  • @timseguine2
    @timseguine2 Před 3 lety +1

    I work on software for an automated processing platform (qPCR and microarray), and it is nice to understand a bit better about how the primers and fluorescence markers work. The only real understanding I had to have was: it grows a lot and glows in this specific way if you do "biology stuff" to it. But it is nice to know what the colleagues are actually up to.

    • @karak962
      @karak962 Před 2 lety

      that’s awesome!!!!!!

  • @lamp7447
    @lamp7447 Před 3 lety +3

    "The Rona" love it

  • @runforitman
    @runforitman Před 3 lety +6

    all the deniers are so frustrating

  • @darkhoodchief
    @darkhoodchief Před 3 lety

    Very informative. I wasn't aware of the LAMP testing but it's very interesting. This video explains why testing is slow in some countries.

  • @papastalin69
    @papastalin69 Před rokem +1

    i currently have covid and this video was very enlightening. thank you :)

  • @Nic4Las
    @Nic4Las Před 3 lety +21

    15:09 are those peas xD

    • @thethoughtemporium
      @thethoughtemporium  Před 3 lety +44

      yup! use them as my resuable ice bucket. they don't melt into a puddle, can be reused, and don't clump into a solid block when refrozen

    • @Nic4Las
      @Nic4Las Před 3 lety +4

      @@thethoughtemporium That is actual genius.

    • @CalebKam
      @CalebKam Před 3 lety +9

      @@thethoughtemporium just make sure to mark them for "NOT FOR HUMAN CONSUMPTION"

    • @CodingCorvus
      @CodingCorvus Před 3 lety

      @@thethoughtemporium in another comment around here someone surgested aquarium gravel. is that good too?

    • @thethoughtemporium
      @thethoughtemporium  Před 3 lety

      @@CodingCorvus Ya it is. I may actually switch to that since I can autoclave gravel to make sure it's not a source of contam

  • @jay-rad8303
    @jay-rad8303 Před 3 lety +6

    I am so glad you made this video! You are educating so many people about such a serious problem and it is honestly people like you that are keeping this world alive. Keep up the amazing work man :)

  • @debug8377
    @debug8377 Před 8 dny

    watching this in 2024 feels weird. a look back 4 years ago while not feeling it was 4 years ago

  • @drugsr4thugs728
    @drugsr4thugs728 Před 3 lety +2

    He really put his blood, sweat, and tears into this video. He pricked his finger, did some pipetting, crying and repeating, and worked on this video for months. Awesome video.

  • @askplays
    @askplays Před 3 lety +3

    Nice i was looking for an explenation of how testing works for a while!

  • @kareng4294
    @kareng4294 Před 2 lety +5

    I was expecting to see something on the PCR thresholds, but they weren't mentioned. What are your thoughts on the recommended threshold of up to 40 cycles? Also, would appreciate any insight on why breakthrough cases only get up to 28 cycles. Thanks!

  • @tanmayghildiyal3149
    @tanmayghildiyal3149 Před 3 lety

    Amazingly Awesome content. Loved it

  • @andrewholway3161
    @andrewholway3161 Před 3 lety

    Nice rant at the end. Wasn't expecting that.

  • @1upquest55
    @1upquest55 Před 3 lety +7

    You poor soul having to copy and paste like 200 links

    • @8b8b8b
      @8b8b8b Před 3 lety +2

      1 Upquest Now imagine reading all of the sources, compiling the information and making it into a video

    • @1upquest55
      @1upquest55 Před 3 lety

      88botong Damn never thought of that

  • @remanjecarter2787
    @remanjecarter2787 Před 3 lety +7

    Ah the science side of this
    I love your videos, they're informative and go into a satisfying depth of the topics

  • @tec4303
    @tec4303 Před 3 lety +1

    Thank you for this video!

  • @XYZAidan
    @XYZAidan Před 3 lety +2

    Thank you for this incredibly informative video. Keep at it, your content is truly next-level

  • @MrAntraxico
    @MrAntraxico Před 3 lety +3

    Seeing that ending now... Oh boy, I sure love how we all got together and tried to solve every important problem we had!
    In any case, thanks for your videos man. I am not in the biomedical field but I love watching your videos and hopefully learning something useful.

  • @FifthCornerRecords
    @FifthCornerRecords Před 3 lety +8

    Most interesting part for me was when you were talking about building your own mask and I saw you guitar in the background! What do you like to play??

    • @SidneyCritic
      @SidneyCritic Před 3 lety

      Thunderstruck and Hotline Bling - lol - TheDooo joke

  • @jorgealonso2238
    @jorgealonso2238 Před 3 lety

    I want to thank you for the fantastic video. I have only watched 2 of your videos so far. One on spiderbeer and this one. I just learned more about my own body and how things work. Your videos are priceless. I'm buying a T :)

  • @marconius101
    @marconius101 Před 3 lety

    thank you for this vid......Much love from the Netherlands...