Why Always My King??? - I'm Better Than My Viewers - Episode 3

Sdílet
Vložit
  • čas přidán 12. 09. 2024
  • If you really enjoy my content, you are more than welcome to support me with a small donation via Paypal.
    Link to Paypal donation: www.paypal.me/...
    Check out my other channel: / randomchessgames
    Xomu - Walpurgis Night
    Xomu - Last Dance
    Subscribe for more funny chess content, and join my Discord server at:
    / discord
    #chess #BetterThanViewers

Komentáře • 610

  • @ZaCh-sb5jt
    @ZaCh-sb5jt Před 2 lety +4317

    Pieces: Casually moving
    Stockfish: SLIDE TO THE LEFT SLIDE TO THE RIGHT CRISS CROSS

  • @Keldor314
    @Keldor314 Před 2 lety +3495

    Gotta love Stockfish's ratings throughout the game.
    Stockfish: "Ha! That's mate in 11! Wait, WTF are you doing? And that response?! Don't either of you know the first thing about chess?!??"

    • @JayJay-wf2oe
      @JayJay-wf2oe Před 2 lety +183

      That's what AI are for, they are excellent at individual things while human are decent at everything :p

    • @me-di2ol
      @me-di2ol Před 2 lety +30

      @@JayJay-wf2oe stockfish just good at everything

    • @niveshproag3761
      @niveshproag3761 Před 2 lety +142

      @@me-di2ol Nah weird positions make stockfish a bit crazy.

    • @me-di2ol
      @me-di2ol Před 2 lety +9

      @@niveshproag3761 Not really, can you give an example with stockfish 14.1? (LEGAL POSITION REQIRED)

    • @kamil118
      @kamil118 Před 2 lety +150

      @@me-di2ol Idk, stockfish is pretty bad at playing poker.

  • @RGC_animation
    @RGC_animation Před 2 lety +4331

    Ok that oponent was still pretty good.

    • @saekashiwagi5829
      @saekashiwagi5829 Před 2 lety +237

      But like the one before him, he didn't attack the vulnerable king at the beginning. Worst, he open HIS King making him vulnerable :/

    • @TylerWx
      @TylerWx Před 2 lety +92

      @@saekashiwagi5829 Yeah, exactly. The King was miles away from any help. Go attack it please, lol

    • @Capivaradissimo
      @Capivaradissimo Před 2 lety +10

      nah cap, I should attack his king at the first moment.

    • @froopea9094
      @froopea9094 Před 2 lety +17

      I mean the only way to do that was with knights because pawns cannot go backwards and knights are the only pieces that can jump and idk if you can checkmate with knights when you only have 2 rows of room

    • @KayOScode
      @KayOScode Před 2 lety +3

      Wasnt he only like 1150?

  • @groundedgaming
    @groundedgaming Před 2 lety +1746

    Thanks, Simp
    I faced a 1100 in this position countless times.

    • @Cripplified
      @Cripplified Před 2 lety +64

      Honestly gotta respect Simp for putting out a video on standard, theoretical chess for once.

    • @bobon123
      @bobon123 Před 2 lety +80

      The Classic "magic trick" opening, where black ends up with 16 pawns. Interesting you need two chess sets to perform it properly, and an opponent that is easy to distract.

    • @adventurer3288
      @adventurer3288 Před 2 lety +5

      Now I finally know what to do in this position!

    • @groundedgaming
      @groundedgaming Před 2 lety +10

      @@bobon123 OHHH!!! SO THAT WAS THE NAME OF IT!!!
      *THANK YOU SO MUCH*
      I HAVE BEEN LOOKING FOR IT FOR A WHILE NOW

    • @clawboss2028
      @clawboss2028 Před rokem

      an 1100*

  • @Tytoalba777
    @Tytoalba777 Před 2 lety +1567

    For some reason, for the first half of the video, I thought the back row pawns could move backwards to check the white king

  • @jotaro8546
    @jotaro8546 Před 2 lety +601

    1:47 it‘s a blunder because he can take the pawn with the bishop and you can‘t take the bishop back because he can take your rook with his queen afterwards

    • @szmash3726
      @szmash3726 Před 2 lety +24

      Exactly. Bxg4 and You can’t take bishop because it’s pinned to the rook.

    • @timothyLucasJaeger
      @timothyLucasJaeger Před 2 lety +95

      I thought so too at first, but this isn't why. This was 6.g4. If black responds 6...Bxg4 as you suggest, 7.fxg4 Qxh1 8.gxh5 is indeed good for black even though white nets a piece, because black's passed g and h pawns are very strong.
      However, 7.Bg2 is still "ok" ("only" -5.69). The real reason 6.g4 is a blunder is that black can play 6...Kf4! preparing ..Qe5 followed by ...d5+. This plan is a little too fast for white to find counterplay and black mates quickly. For example, 6.g4 Kf4 7.Bg2 Qe5 8.Qg1 threatening Qh2# is a move too slow for white. 8...d5+ is mate in 4.

    • @szmash3726
      @szmash3726 Před 2 lety +7

      @@timothyLucasJaeger oh I see. Thank you

    • @mrjoe5292
      @mrjoe5292 Před 2 lety +3

      If you take the rook on h1 then white can take black's rook on the h5. Overall it's better for white, a bishop and rook for a pawn and rook. Although the black queen on h1 is tricky, pinning the bishop and blocking white's queen with both f2 and g3 protected by pawns.

    • @Kamil-kv6lv
      @Kamil-kv6lv Před rokem

      @@mrjoe5292 it would be better for black, because white has pieces locked and queen trade is likely

  • @matt92hun
    @matt92hun Před 2 lety +617

    Twist: we didn't see the resignation because there wasn't one.

    • @cosmictrash697
      @cosmictrash697 Před 2 lety +37

      next video his opponent is randomly going to resign with a checkmate in one for him(the opponent)

    • @52flyingbicycles
      @52flyingbicycles Před 2 lety +44

      I don’t think black can do anything to prevent pawn f4 checkmate in this position. Stockfish say M1 and it’s black’s turn.

    • @BlueEyes-WhiteDrag0n
      @BlueEyes-WhiteDrag0n Před 2 lety

      @@52flyingbicycles black can hack into the server and make moves for white

    • @AndreasChrisWilhelmer
      @AndreasChrisWilhelmer Před 2 lety

      @@cosmictrash697 whelp, it just happened xD

    • @Mernom
      @Mernom Před 2 lety +1

      Iirc this chess client doesn't show them.

  • @mrcalligraphy2722
    @mrcalligraphy2722 Před 2 lety +485

    This was really entertaining, nice to see some relatively high level play being broken down.

  • @Kaizu-E
    @Kaizu-E Před 2 lety +283

    The more he wins the stronger simp gets.
    Great video as always, keep it up.

  • @RepostCollection
    @RepostCollection Před 2 lety +47

    The "ah ha" had me in tears every time XD

  • @ED-yy4te
    @ED-yy4te Před 2 lety +38

    Your king was actually safe in that position while the enemy is trapped in the middle.

    • @davidy22
      @davidy22 Před rokem

      King wasn't safe and every move chess simp made up until the first attacking queen move was a blundered mate in 10

  • @musicforever7014
    @musicforever7014 Před 2 lety +4

    3:29, F takes the woman🤣🤣🤣

  • @catcatcatcatcatcatcatcatcatca

    Damn that was a great game, even if neither player spotted the obvious mate in 11. But the ridiculous blunders aside, the game took a very interesting position. Your opponent still has a bit of a weak spot when attacking king behind their pawns behind their king - probably something they need to study in future

    • @pirilon78
      @pirilon78 Před 2 lety +39

      "obvious" and "mate in 11" should never be in the same sentence

    • @rubickevich
      @rubickevich Před 2 lety +16

      Yeah, obvious mate in 11. I saw it too, of course.

    • @EdibleOstriche
      @EdibleOstriche Před 2 lety +6

      @@pirilon78 it's a joke

    • @saitama2467
      @saitama2467 Před 2 lety +1

      ​@@rubickevich the mate was obvious to me, when black moves the pawn to prepare to block the queen mate you take with bishop if he takes back with bishop you take with queen and king is forced into corner and moving the pawn up is mate, if he doesn't take bishop and instead moves into corner queen mates, if he moves behind bishop you take bishop and if he takes bishop there you mate with queen, if he moves back towards the queen you move queen up check force him into corner and pawn up mates

    • @saitama2467
      @saitama2467 Před 2 lety

      ​@@rubickevich basically its just understanding the fundamentals of forcing a mate, move your pieces in instead of blocking sight lines with pawns, even without seeing the mates, taking with bishop is just better because you have more attacking pieces so you want to trade down, if they do trade down mate becomes obvious by forcing them into the corner

  • @jedzenie9770
    @jedzenie9770 Před 2 lety +16

    Watching these videos while having absolutely ZERO idea about how chess works is so damn fun

  • @NateTheOhioan
    @NateTheOhioan Před 2 lety +12

    I feel like this is just the pieces going on a mission to save their already captured king

  • @cobalius
    @cobalius Před 2 lety +24

    Finally an opponent who was able to set up little tactics xD

  • @Jasper-yz7vy
    @Jasper-yz7vy Před 2 lety +14

    Did I just see a Mate in 21?

  • @BleachWizz
    @BleachWizz Před 2 lety +23

    1:47 -
    I guess stockfish saw
    Bishop takes g4
    Pawn takes g4
    Queen takes h1
    Pawn takes h5
    And now his queen is pinning your bishop. And the only next move that doesn't cause at least a trade is queen e1.
    But it's not your turn so probably i think:
    Pawn c3
    pawn takes c3
    Knight takes c3
    Queen e1
    Queen e6
    And now you're back with only being able to move the rook without giving pieces.

    • @ritamdutta5860
      @ritamdutta5860 Před 2 lety +1

      Opponent saw Bishop g4. He just didn't like it.

    • @makj155
      @makj155 Před 2 lety +2

      I think you got the first half right, but the second half is a bit wrong. The opponent could move their pawns forward to promote on the last two columns after pawn takes h5. The only way to stop it would be the bishop taking the pawn which would mean sacrificing his queen.

    • @Whatever-gi4rx
      @Whatever-gi4rx Před 2 lety

      You are all wrong, its king f4 where he is completely safe, taking either piece will result in Qe5 and d5 and a mate in a few turns with the queen getting out.
      Best response to kf4 by stockfish is c5 with the intention to go cxd4 + saccing material to basically just prolong the game.

    • @supC_
      @supC_ Před 2 lety

      @@Whatever-gi4rx Ok, you lost me at “best response to Kf4 is c5. That’s not even a possible move. Did you mean c3? Other than that, your logic makes a lot of sense.

  • @knownas2017
    @knownas2017 Před 2 lety +74

    Imagine if Hikaru just.. drops a comment.
    "You're better than your viewers?"

    • @CodaRyu
      @CodaRyu Před 2 lety +5

      Oh no

    • @lordpumpkinhead265
      @lordpumpkinhead265 Před rokem +10

      The Chess equivalent of bringing in a retired Marine to teach gym class.

    • @user-up7nb6id1f
      @user-up7nb6id1f Před rokem

      @@lordpumpkinhead265 active*

    • @lordpumpkinhead265
      @lordpumpkinhead265 Před rokem +6

      @@user-up7nb6id1f If it was an active marine, then there'd be nothing to teach as said marine would be deployed on a military base.

    • @smurfaccount9269
      @smurfaccount9269 Před 3 měsíci

      @@lordpumpkinhead265 It's not the chess equivalent then since he's not retired no?

  • @ironclad452
    @ironclad452 Před 2 lety +11

    Didn't see your opponent resign so I don't believe you

    • @Capivaradissimo
      @Capivaradissimo Před 2 lety +3

      I actualy resign cause I dont have nothing else to do

  • @zakarikante9674
    @zakarikante9674 Před 2 lety +688

    Chess but it's actually a paid actor (Day 3 of asking)

  • @wynoglia
    @wynoglia Před 2 lety +24

    Wow. I thought this was going to be losing, and fast
    But damn this exceeded my expectations a million times

    • @oanhienlong7264
      @oanhienlong7264 Před 2 lety

      It was losing, his opponent just fails to exploit the advantage. Any 1800+ could handle the situation like how it should be.

    • @cadiskox8073
      @cadiskox8073 Před 2 lety

      @@oanhienlong7264 me being 1000 would do it completely differently, it's hard to believe 1100 failed so hard with that advantage

  • @masturbates
    @masturbates Před 2 lety +3

    This channel is criminally underrated. Forget the other chess channels, this is where it's at

  • @AlexMoreno-zj7po
    @AlexMoreno-zj7po Před 2 lety +2

    for some reason this is perhaps my favorite of your videos

  • @missedelweiss8771
    @missedelweiss8771 Před 2 lety +20

    The "I'm Better Than My Viewers" series is so interesting!

  • @tr0n4556
    @tr0n4556 Před 2 lety +1

    Stockfish just spent the entirety of the game just spitting random numbers and saying it was good enough. Poor bastard was so confused

  • @76soccerlover
    @76soccerlover Před 2 lety +1

    3:29 “fx the woman”←Amazing dialogue!🤣🤣🤣🤣

  • @michaelmoccio2225
    @michaelmoccio2225 Před 2 lety +2

    I love the idea of this series, even if you lose it will still have high comedic value but I definitely appreciate you winning for your sake. Great game as always!

  • @TheGamingPalace123
    @TheGamingPalace123 Před 2 lety +57

    Simp: *I am better than my viewers*
    Carlsen: _Enters the chat_
    What you said?
    Simp: *Did i said something?*

  • @johnlucas2838
    @johnlucas2838 Před 2 lety +5

    1:01 Instead of taking g3 black pawn, you could have just moved f2 white pawn to f4 for checkmate.

    • @kickstart3974
      @kickstart3974 Před rokem

      I came here looking for someone to notice it I'm not that good at chess rn so it kind of drove me crazy that someone miles ahead of me didn't catch it, but it happens

    • @deboogs
      @deboogs Před rokem +3

      Black could en passant with the e pawn to avoid checkmate

    • @peterjohnson11655
      @peterjohnson11655 Před rokem +1

      @@deboogs holy hell

  • @W4rfire
    @W4rfire Před 2 lety +18

    Wow that was really an impressive 1100. He was even impressing by resigning, because this meant he sees he cannot defend anymore

  • @janellysosa7590
    @janellysosa7590 Před 2 lety +1

    The bishop at the back could demolish your king but he didnt see

  • @Molten404
    @Molten404 Před 2 lety +1

    You: that blunders qe5
    Stockfish: that blunders m2

  • @tobuslieven
    @tobuslieven Před 2 lety

    I cannot believe the respectful resignation. That guy is good and decent.

  • @oicmorez4129
    @oicmorez4129 Před 2 lety +12

    fix title, but great video!

  • @far_centrist
    @far_centrist Před rokem

    He decided to resign rather than face a humiliation of getting checked by a pawn.

  • @DandDgamer
    @DandDgamer Před 2 lety +3

    Super entertaining video, well balanced and a great struggle!

  • @connorhorman
    @connorhorman Před rokem

    "Oh no my queen"
    Ah, I see you're a man of culture as well.

  • @NaThingSerious
    @NaThingSerious Před 2 lety

    Stock fish just dancing on the side as it tries to figure out wtf is happening

  • @UselessBunny
    @UselessBunny Před 2 lety +3

    1:45 is a blunder because he can just take with his bishop and then when you take back with the guarding pawn you loose the rook in the bottem right corner to the queen.

    • @GuardianHalberd
      @GuardianHalberd Před 2 lety

      It's either something else or a deeper move, because taking rook with queen also allows black rook to be captured in sequence with pawn that took bishop

    • @UselessBunny
      @UselessBunny Před 2 lety

      @@GuardianHalberd Lets count it down you take a bishop and a pawn and loose a rook and two pawns ? That is 4 for 7 that seems like a blunder to be.

    • @GuardianHalberd
      @GuardianHalberd Před 2 lety

      @@UselessBunny I didnt get it.
      black moves, Bxg4
      white moves, fxg4
      black moves, Qxh1
      white moves, gxh5
      black loses bishop+rook, white loses pawn+rook
      black has less material now

    • @oanhienlong7264
      @oanhienlong7264 Před 2 lety

      @@GuardianHalberd wdym you don't get it, look at the back 8 pawns, that shit is gonna crashing down and white is gonna be the one giving up pieces to stop the insane promotions coming up.

    • @oanhienlong7264
      @oanhienlong7264 Před 2 lety

      @@GuardianHalberd I don't get how most of the viewers do not understand how black is having a hugely winning game and his opponent is just too weak to get it right.

  • @kalleleikos5260
    @kalleleikos5260 Před 2 lety

    Eric Rosen is proud of you! Oh no my queen for smothered pawn mate is so beautiful

  • @no_name4796
    @no_name4796 Před 2 lety +1

    1:48 it's a blunder because: bishop eats pawn, pawn eats bishop, queen can now eat your tower and you basically lost

  • @bruhnca
    @bruhnca Před 2 lety +2

    I think that on 1:02 you couldve given a checkmate by moving your pawn to f4 since its protected by the bishop

    • @rango4030
      @rango4030 Před 2 lety +1

      Yes, he could have how did no one see that?????

    • @sandatanidamocles
      @sandatanidamocles Před 2 lety

      Correct me if I’m wrong but wouldn’t a French move kill his pawn?

    • @bruhnca
      @bruhnca Před 2 lety

      @@sandatanidamocles sorry i dont know what a french move is i dont know a lot of terms in chess💀but i dont think anything couldve stoped it

    • @sandatanidamocles
      @sandatanidamocles Před 2 lety

      @@bruhnca En Passant, I mean. It’s a specific move that allows your pawn to capture an opponent’s pawn if the opponent does the two space jump of their pawn to go beside your pawn.

  • @pikachudj8069
    @pikachudj8069 Před 2 lety +18

    I can't believe you didn't see mate in 21. I thought you were an AI because of your computer voice. Guess you just need to play more games to get more experience.

  • @synka5922
    @synka5922 Před rokem

    1:40 the blunder is that if he takes the pawn with his bishop, and you take the bishop, that blunders your rook so its really just a free pawn. and if you do take the bishop and then his rook, he still has 4 pawns on a side with no rook to oppose him

  • @MrKyle-dy4en
    @MrKyle-dy4en Před 2 lety

    When the computer starts a chess CZcams channel

  • @waldoman7
    @waldoman7 Před 2 lety +1

    That would be a priveledge of a game to lose. Well done to that guy

  • @khangtrantan9756
    @khangtrantan9756 Před rokem +1

    Mean while in an alternate universe
    1:00 pawn F4, checkmate

  • @coolskeletondude5902
    @coolskeletondude5902 Před 4 měsíci

    1:47 after Bxg4 and Recaptures with pawn his queen takes your undefended rook

  • @unknownunknown6500
    @unknownunknown6500 Před 2 lety

    At 1:45 the blunder is if bxg4 your f3 pawn can't take it because its protecting the h1 rook from the d5 queen's diagonal.

  • @Lillyluri
    @Lillyluri Před rokem

    Fascinating to watch!

  • @hans935
    @hans935 Před 2 lety

    2:45 take with the bishop... blundering ur piece to force moves is the next level game play. (That was a mate in 2...)

  • @kalahatze
    @kalahatze Před 2 lety +1

    1:45 Just a guess, I'm not very good at chess, but Stockfish probably wants black to move his king, ignoring the fork in order to get his queen out. Moving the pawn opens up the space it was guarding from the king, and there is probably a forced mate if black ignores the fork.

  • @saxorskittle3839
    @saxorskittle3839 Před 2 lety +3

    Chess, but you can’t move any other pieces (or pawns) until either, or both, of your knights have taken 5 pieces (including pawns)

  • @andrewchapman2039
    @andrewchapman2039 Před 2 lety

    A proper tense one, love the high stakes series!

  • @NaThingSerious
    @NaThingSerious Před 2 lety

    Is it just me who love the way he says “aha”

  • @sheeppro1463
    @sheeppro1463 Před 2 lety +8

    YOU LITERALLY MISSED CHECKMATE ON THE 3RD MOVE! Pawn moves to f4. How the hell did you miss that

    • @sanderkoekkoek7863
      @sanderkoekkoek7863 Před 2 lety +2

      No, opponent can take pawn by en passant

    • @sheeppro1463
      @sheeppro1463 Před 2 lety +1

      @@sanderkoekkoek7863 forgot that can happen cuz it was so close

  • @Sinfinity7
    @Sinfinity7 Před 2 lety

    1:45 Queen is xraying the f-pawn, black can just take. Yes you win the exchange but basically cant move anymore.

  • @heatpete5106
    @heatpete5106 Před 2 lety

    Him: ha
    Him again: HA!

  • @brettd4599
    @brettd4599 Před 2 lety +1

    This series is hilarious

  • @valiant8987
    @valiant8987 Před rokem

    1:49 I think stockfish calls this a blunder because the bishop can take the pawn on g4 due to your f3 pawn being pinned by the queen.

  • @drrianblox
    @drrianblox Před 2 lety +2

    Episode one, the third episode

  • @JohnSmith-ox3gy
    @JohnSmith-ox3gy Před 2 lety

    Sweating stockfish: But this isn't a legal board state!

  • @blacklight683
    @blacklight683 Před 2 lety +1

    5:03he was like yes *yes* YES until he saw his king no *no* N- (*player disconnected*)

  • @Thats_quite_cool
    @Thats_quite_cool Před 2 lety +3

    1:50 the problem with this is that the Bishop on F5 can take the pawn on G4 and you wouldn’t be able to take the bishop with your other pawn because then he could do QH1 to take your rook

    • @selectivepontification8766
      @selectivepontification8766 Před 2 lety

      The bigger problem is that now black can play Kf4 which opens up Qe5 into d5+ discovered check and then the king is locked in with a queen and bishop and probably gets mated in a few moves

    • @Phillitopolis
      @Phillitopolis Před rokem

      @@selectivepontification8766 And the biggest problem is that white missed an unstoppable Queen pin with his bishop to G2. No matter what black plays in the next move, white has f4, checking the king with discovered attack on black's queen.

  • @Acid31337
    @Acid31337 Před 2 lety

    Famous "oh no, my queen"

  • @grantarmstrong2968
    @grantarmstrong2968 Před rokem

    1:50 it is a fork, but the bishop can take it, and since taking the bishop gives up your rook you will be down material

    • @grantarmstrong2968
      @grantarmstrong2968 Před rokem

      I just realized you’d still have their rook from this, but I imagine them taking a rook is worth a lot more since you have a lot less pieces

  • @OptimusSubPr1me
    @OptimusSubPr1me Před 2 lety

    Stockfish wants off this wild ride.

  • @Theresia66
    @Theresia66 Před 2 lety

    This is the 4th chess game i've ever watched, i am confused again

  • @freddie9705
    @freddie9705 Před 2 lety

    This is such a tense game! The faintly anime music feels really appropriate

  • @Xehanort107
    @Xehanort107 Před rokem

    dude literally had checkmate all game, and playing through begging the opponent to stop him for like 10 moves.

    • @ManosSef
      @ManosSef Před rokem

      What checkmate are you talking about?

  • @THAC0MANIC
    @THAC0MANIC Před rokem

    so @1:49 i think the reason why stock fish hates it is, Black takes pawn is Bishup you retake with pawn? his queen takes your Rook, he trades a Bishup for a rook basicly, if you block / defend the pawn with your Bishup, black just moves his H Pawn to attack. if you attempt to check his king he defends with a pawn still has that row open, if you take his attacking pawn, his Bis takes your Bis so on so forth, basicly from what i can tell one way or another he is able to trade into said pieace and if you attempt to capture back he just ends up winning a Rook for his Bishup and while you can take his Rook back in exchange it did open up like 2 Pass Pawns for him.
    Edit: and pinning your Bishup to your queen, thus if it moves, he takes your queen. better then i thought once i open up stockfish and look for myself.

  • @C_Castillo
    @C_Castillo Před 2 lety

    Hahah i could wipe the floor with this guy lol

  • @TheOppiter
    @TheOppiter Před rokem +1

    awesome music

  • @jackscott1218
    @jackscott1218 Před rokem +1

    I have nothing to say I'm just commenting to boost the algorithm :)

  • @JaguarBST
    @JaguarBST Před 2 lety

    1:46 if black takes the pawn you can’t take back because your rook would hang, that’s why it’s a blunder.

  • @FavvvvazM
    @FavvvvazM Před 2 lety +2

    Great video today!

  • @nguyennhoangnam28
    @nguyennhoangnam28 Před 2 lety +12

    Why does the title “Episode 1”?

    • @merdishakki
      @merdishakki Před 2 lety

      Because it's the episode 1

    • @zionj104
      @zionj104 Před 2 lety +1

      @@merdishakki no, this is ep 3

    • @honzik7435
      @honzik7435 Před 2 lety +1

      @@merdishakki its 3rd opponent

    • @merdishakki
      @merdishakki Před 2 lety

      what do you mean

    • @thesmasher.
      @thesmasher. Před 2 lety +1

      @@merdishakki there were 2 episodes before this episode

  • @opus5770
    @opus5770 Před rokem

    "Oh no my queen" 🤣

  • @panzerhund7836
    @panzerhund7836 Před 2 lety

    When the enemy has your king hostage but all youre giving him is your flank

  • @codeovercode167
    @codeovercode167 Před 2 lety +11

    I'd love to challenge you as a 1550.

    • @honsuaman8743
      @honsuaman8743 Před 2 lety

      What is his own rating btw?

    • @oanhienlong7264
      @oanhienlong7264 Před 2 lety

      @@honsuaman8743 Idk, but I'd love to know, most of the cases he is against incompetent opponents which sucks out the fun for me. I was screaming for the obvious moves so many times that his opponent doesn't take to took him down on the spot.

    • @andeolevain
      @andeolevain Před 2 lety

      Nobody knows, but definitely more than 1550. Would be interesting to find the right setup for a "I'm better than my viewers" game at this level.

  • @user-hp6uk5ht8j
    @user-hp6uk5ht8j Před 2 lety

    The opponent not even attacking the king

  • @why1513
    @why1513 Před 2 lety +1

    At 1:03 pawn f4 was a checkmate in 1.

    • @ManosSef
      @ManosSef Před rokem +1

      After that, en passant is forced. So it's not checkmate.

  • @mihirkarwani8891
    @mihirkarwani8891 Před 2 lety +27

    Only legends know that the title was named "Episode 1" instead of "Episode 3"

  • @janseta5162
    @janseta5162 Před 2 lety +1

    at 1:00 I thought you had checkmate by moving your pawn to threaten King, but then I realized en passant would have gotten you

    • @biggbluecanoe7108
      @biggbluecanoe7108 Před 2 lety

      Just watching this video now, and I made the same comment! Apparently it's due to the "en passant" rule, where a pawn can capture another pawn that just moved two spaces by moving to the tile behind that pawn (probably butchered that explanation). Essentially, if he moved his pawn to f4, the enemy pawn at e4 would be able to capture it by moving diagonally to f3.

  • @sufferman1
    @sufferman1 Před 2 lety +1

    Magnus in disguise

  • @monacle7467
    @monacle7467 Před 2 lety

    1:45 I believe it's a blunder because if the bishop takes and you take back with the pawn you lose your rook

    • @crowreligion
      @crowreligion Před 2 lety

      Then you could also take black's rook with the pawn

  • @weewoogee
    @weewoogee Před 2 lety

    as someone who doesn't know the difference between the queen and king cool video

  • @xtentasticx
    @xtentasticx Před rokem

    1:45 He should have taken the pawn with his bishop.
    If the pawn takes, queen wins a rook

  • @shmockette7158
    @shmockette7158 Před 2 lety +1

    At 1:50 I'm surprised you don't see it:
    It's because of Bxg4, fxg4, Qxh1 and then Rxh1 because then both your Queen and bishop are permanently out of the battle and he can just move his pieces backwards to your king.

  • @sorryeverafter523
    @sorryeverafter523 Před 2 lety

    Quite impressive I must say. Maybe you are not chess simp, but chess god sandbagging

  • @AutumnReel4444
    @AutumnReel4444 Před 2 lety

    That was the best one yet imo

  • @TheWarmestWaffle
    @TheWarmestWaffle Před 2 lety +1

    Chess simp didn’t even see the mate in 9 at 2:45. If it were me I’d have executed it flawlessly.

  • @TheQuark6789
    @TheQuark6789 Před 2 lety

    Wow, this one was a wild ride. I like it.

  • @KevinTyler123
    @KevinTyler123 Před 2 lety +1

    That's an amazing game.

  • @mence5992
    @mence5992 Před 2 lety

    In the fork if bishop take and you take with the pawn he can get the rook with the Queen. You take the rook. So he loses a bishop for a pawn instead of a rook.

  • @user-cd4bx6uq1y
    @user-cd4bx6uq1y Před rokem +1

    He could just take the damage and slowly block your king tho

  • @timwhite1783
    @timwhite1783 Před 2 lety +1

    2:32 Mate in 11?? wild... would be really curious what that is.

  • @addymant
    @addymant Před 2 lety +2

    Yeah stockfish really struggles with such a weird board

  • @folushooludare786
    @folushooludare786 Před 2 lety

    Man just rescued his king who has been held hostage lmao