The Plans to Assassinate Hitler

Sdílet
Vložit
  • čas přidán 5. 09. 2024
  • Visit fern.deals/bri... for 20% off of a premium subscription. Start learning new skills today! It's also a great way to support our channel. (ad)
    This is a video about the craziest plans to assassinate Hitler.
    Sources: docs.google.co...
    Music:
    Epidemicsound:
    Christoffer Moe Ditlevsen - Enter the Realm of Shadows
    Guy Copeland - Ahead of the Game
    Christoffer Moe Ditlevsen - Ghosting
    Lennon Hutton - Whispers in the Fog
    DEX 1200 - Uncharted Territories
    Jon Bjork - Slow Revolt
    Amber Glow - Pensive Gaze
    Artlist:
    C.K. Martin - Attack on London
    Out of Flux - Surrendered
    Tilman Sillescu - There Is No Time
    Brianna Tam - Intrepid
    Marco Martini - Theater Magnus
    Jakub Pietras - Solving the Mystery
    Quinten Coblentz - Monster Within
    Ardie Son - Fury
    Kyle Preston - Eternal Recluse
    Naama Zafran - Earth.wav
    Lensdistortions:
    Inversion (no percussion)
    The Music Room:
    A Step In The Right Direction - Tom Fox
    _____
    Armchair documentaries, almost weekly

Komentáře • 2,9K

  • @fern-tv
    @fern-tv  Před měsícem +7518

    The timing of this video might seem a bit weird. Naturally, it is entirely coincidental; we worked on this for months. Enjoy!

    • @大
      @大 Před měsícem +250

      daddy

    • @JohnCena-rq4bp
      @JohnCena-rq4bp Před měsícem +102

      i'm watching this in the bath 👍

    • @vermillion-sz7vy
      @vermillion-sz7vy Před měsícem +82

      props to your animation team on your other works, I assume this will be great

    • @actuallyalyan
      @actuallyalyan Před měsícem +1

      Its ok, trump is no worse than hi!ler

    • @pyeitme508
      @pyeitme508 Před měsícem +27

      Bruh

  • @4GENS
    @4GENS Před měsícem +11682

    This is the plots that would make you quit watching a show because it's too "unrealistic"

    • @kaydens6964
      @kaydens6964 Před měsícem +478

      If you think about it, what happened to Trump is pretty a Mr Bean movie.

    • @kayaphus4303
      @kayaphus4303 Před měsícem +10

      Lessons for Trump

    • @Notell.
      @Notell. Před měsícem +9

      ​@@BringOutTheLobster.Don't be so jealous. He planned it out and flew a drone 😂 your daddy isn't protected

    • @markeverhart-xu7hh
      @markeverhart-xu7hh Před měsícem +3

      @@BringOutTheLobster.that’s what you think .

    • @matteframe
      @matteframe Před měsícem +7

      when I saw the guy wearing a racoon hat and bull horns in the Senate chambers, I knew the show had jumped the shark

  • @astral6749
    @astral6749 Před měsícem +9275

    Resistance: * fails to kill HItler *
    Hitler: Fine, I'll do it myself.

    • @Krachbumm-Ente
      @Krachbumm-Ente Před měsícem

      Imagine believing post war propaganda

    • @creely123
      @creely123 Před měsícem +78

      Argentina actually.

    • @edvardb.2751
      @edvardb.2751 Před měsícem +29

      He had the last card.
      The death card.

    • @BGwxlf
      @BGwxlf Před měsícem +63

      ​@@creely123no he didnt escape dna tests were done on his bones if im not mistaken

    • @BGwxlf
      @BGwxlf Před měsícem +9

      Underrated commemt

  • @alvin3698
    @alvin3698 Před měsícem +4440

    Every assassination attempt had a chain of time travelers trying to stop each other from killing or saving Hitler

    • @mao-tse-tung-games
      @mao-tse-tung-games Před měsícem +352

      True man. Butterfly effect: if hitler died, maybe someone more competent might have assumed his place, and the world wouldnt be the same.

    • @ExtantPerson
      @ExtantPerson Před měsícem +224

      @@mao-tse-tung-gamesYep. That’s exactly why the Allies eventually stopped trying to kill him. They realized he was more detrimental to the enemy than beneficial

    • @EEEEEEEE
      @EEEEEEEE Před měsícem +7

      E‎ ‎

    • @derederekat9051
      @derederekat9051 Před měsícem

      @@ExtantPerson yup, now they can move uninterrupted destroying Europe thanks to the holocaust blame! Genius move!

    • @aaronmurray7308
      @aaronmurray7308 Před měsícem +22

      That would be a great movie idea

  • @Emil-y3z
    @Emil-y3z Před měsícem +1395

    Don`t also forget he was saved from drowning by a priest when he was young and a British solder refused to shoot him in ww1. Mann, he was very lucky.

    • @SynthiaVan
      @SynthiaVan Před měsícem +75

      The 2024 version is "he was protected by god."

    • @MaddAddam93
      @MaddAddam93 Před měsícem +39

      This just affirms that life is chaos and good does not intrinsically succeed more than evil

    • @martialhero9544
      @martialhero9544 Před měsícem +21

      @@SynthiaVanor by the devil

    • @MoAbuAkb
      @MoAbuAkb Před měsícem

      No by god ​@@martialhero9544

    • @TruffoYT
      @TruffoYT Před měsícem +7

      Dawg that story isn’t true

  • @augustus4832
    @augustus4832 Před měsícem +1527

    "Hitler commited ' ' in his bunker"
    God, I hate CZcams's censorship of certain words for historical videos.

    • @Willy_Tepes
      @Willy_Tepes Před měsícem +80

      It is political censorship, but often it affects historical videos.

    • @SizzleCorndog
      @SizzleCorndog Před měsícem +128

      @@Willy_Tepesit’s not even political, they’re just trying to avoid language that would put at risk people on edge

    • @Willy_Tepes
      @Willy_Tepes Před měsícem +37

      @@SizzleCorndog No, it is definitely political. I have been probing and tracking this since 2007. There is a logical reason why you can't see this. You hold no opinions that go against the media narrative.
      If people knew what was really going on, I am sure some would be very angry..

    • @SizzleCorndog
      @SizzleCorndog Před měsícem

      @@Willy_Tepes Thats total bs, in 2007 youtube barely existed and was more interested in showcasing what videos were being actively watched. This was the peak of CoD where people were calling each other slurs or telling them to kill themselves for no reason. Nobody gave a shit back then.
      The reason they're actually doing this is because there are people who exist that are fighting with whether they should be alive or not and mentioning topics like suicide or self harm might be enough to either send them over the edge or relive some past experiences. This isn't anything new either, people don't like talking about it to the point where back in the day people would say someone "died of grief" or "died of melancholia" instead of just saying they took their own life.
      The reason you're here moaning and groaning about this is probably because you saw Hitler in the title and thought "finally, more content for me and my Ai Hitler pfp" and then were surprised when they approached the topic with a crumb of sensitivity. But no, its all a narrative created to stop you specifically and keep the rest of us sheeple in line rather than, you know, be respectful of other peoples feelings and experiences.

    • @cuboidmelon
      @cuboidmelon Před měsícem +131

      ​@@Willy_Tepes no its not, it's most likely simply the fact that companies don't want to be associated with negative/controversial topics. If youtube didn't censor stuff they wouldn't get money from running ads. Most corporate decisions are made for monetary reasons and not political.

  • @fbiagentmiyakohoshino8223
    @fbiagentmiyakohoshino8223 Před měsícem +3489

    40 assassination attempts, and he just kills him self in the end

    • @psychrubus4503
      @psychrubus4503 Před měsícem +82

      lol Fidel Castro had major plot armor too

    • @bigpapaplantman5126
      @bigpapaplantman5126 Před měsícem +1

      I don't believe he killed himself personally. I think he went to Argentina with the rest of his regime. Still to this day, Argentina has villages in the mountains where people speak German, and there have been 1,000's of high ranking nazi medals found in some of the homes. I think the IDF located him and assassinated him some time in the 60's. Just a theory but totally plausible

    • @memorimusic420
      @memorimusic420 Před měsícem +148

      Hitler was like: "if yall cant do it imma do it myself" 😭

    • @user-pf9rf3sr1q
      @user-pf9rf3sr1q Před měsícem +5

      MYAA NEE

    • @aittttttttttttt
      @aittttttttttttt Před měsícem +16

      we dont know that

  • @SIMULATAN
    @SIMULATAN Před měsícem +2576

    held a presentation about the stauffenberg attempt in school, its insane how miniature things like a person moving a briefcase by a few centimeters prevented attacks from succeeding and history changing forever

    • @BouXIII
      @BouXIII Před měsícem

      also not forgetting that stauffenberg was no saint. he planned to stop the nazi regime, but wanted to impolement aristocracy again and stop all democratic ideas

    • @dingsda0412
      @dingsda0412 Před měsícem +49

      butterflyeffect

    • @EEEEEEEE
      @EEEEEEEE Před měsícem +1

      E‎ ‎

    • @CantTellYou
      @CantTellYou Před měsícem +20

      And, not so miniature but, the allies bomb causing their fancy new costume ceremony to be canceled. I wonder, what would’ve it been like if Stauffenberg and crew had succeeded? Would it eventually just became another, slightly less genocidal dictatorship? idk much about the guy lol

    • @aezurefx
      @aezurefx Před měsícem

      @@dingsda0412 was about to say that

  • @armansinghbhati8446
    @armansinghbhati8446 Před měsícem +3801

    Two assassination attempt videos in 2 weeks is MAPPA levels of crazy

    • @moshymosh
      @moshymosh Před měsícem +105

      Weird reference but ok

    • @Adnan-qf2rz
      @Adnan-qf2rz Před měsícem +26

      hes being held captive in some1s basement or sum

    • @Paradoxical124
      @Paradoxical124 Před měsícem +15

      No it isn’t, you’re just young.

    • @lennywhere
      @lennywhere Před měsícem +75

      @@moshymosh weird because the employees of MAPPA are literal slaves or weird because it's an anime prod. company xdxdxd

    • @Hello-There.-General-Kenobi
      @Hello-There.-General-Kenobi Před měsícem +6

      Could you or anybody else explain to me to what op was is referring to please? I know MAPPA but what does it have to do with assassination attemps?

  • @Zero_Zero_0_0
    @Zero_Zero_0_0 Před měsícem +317

    You forgot to add 2 crucial parts in which the meeting was supposed to take place in secured underground concrete bunker but was changed at the last minute due to the extreme heat, and not to mention that initially Staufenburg places the briefcase as close to Hitler, but was unintentionally moved further away by Col. Brandt, thus contributing to another factor as to why he survived the explosion.

    • @InterlacedStudios1
      @InterlacedStudios1 Před měsícem +5

      Noticed that too because I had to learn all about this stuff last year on school

    • @KingK2205
      @KingK2205 Před měsícem +1

      Did Col Brandt survive?

    • @tom12-128
      @tom12-128 Před měsícem +3

      No you are wrong: „It is often falsely claimed that the meeting should actually have taken place in one of the underground bunkers of the Wolf's Lair.“

    • @bronnquist
      @bronnquist Před měsícem +3

      Yes agree, pretty big thing to mention that the bomb was moved.

    • @After-all-this
      @After-all-this Před 23 dny

      Imagine if col was a time traveller

  • @catcatcatcatcatcatcatcatcatca

    The style of animations is stroke of genius. The little balls tie the keyframes together, as well as look good with low poly details. It really ties the story together, and allows very strong storytelling with the contrasting colors.

  • @Hungrydinoinyigo
    @Hungrydinoinyigo Před měsícem +13269

    bro Hitler literally has plot armor

    • @nietur
      @nietur Před měsícem +199

      @@TehUltimateSnake the plot (armor) ended

    • @creativename.
      @creativename. Před měsícem +40

      Bro fr

    • @agrajyadav2951
      @agrajyadav2951 Před měsícem

      Yeah the only man who killed Hitler was Hitler himself

    • @reditoao
      @reditoao Před měsícem +260

      just like a little orange somebody 🙄

    • @volatileM.
      @volatileM. Před měsícem +79

      ​@@nieturlogically if your plot armor is strong af , the only way to die is suicide 😂

  • @ScarySkele
    @ScarySkele Před měsícem +1097

    Just a reminder to people: This video took months to make as do all of them, the previous one not to be mentioned was simplistic in comparison to this so obviously it was pumped out quicker. Don’t judge him on the basis of coincidence, judge him on the basis of journalism, effort, research, and knowledge sharing.
    fern-tv has my upmost respect.

    • @tmsupreme7763
      @tmsupreme7763 Před měsícem +22

      They released a video about Trump's assasination before this one, I mean I don't mind but still..

    • @ScarySkele
      @ScarySkele Před měsícem +34

      @@tmsupreme7763
      I get that, though if you were working on a project for months then got a simpler project done while doing the big one, I think you would empathize with Fern at that point. It isn’t a matter of Trump first, Hitler second. It is a matter of upload main project second, side project first.

    • @s-ata-n
      @s-ata-n Před měsícem +3

      THERE IS NO PROOF JEFFREY EPSTEIN KILLED HIMSELF

    •  Před měsícem +76

      It is not a coincidence. Bruh has no one here had history classes? 😭 It was the 80th anniversary of this assassination attempt on hitler!

    • @Eisbaer_2912
      @Eisbaer_2912 Před měsícem

      ​@@s-ata-n maybe not for that, but for other videos

  • @jaunitaquinlivan
    @jaunitaquinlivan Před měsícem +650

    10:18 I actually went to the place where it happened. It is also worth noting that the briefcase wasn't in the place that it was placed first. Someone had moved the briefcase behind the wooden leg of the table because it was in the way. This caused the explosion to be less impactfull to Hitler as he was further away from the bomb and the wooden leg took some impact on itself.

  • @friend
    @friend Před měsícem +31

    The rate at which these videos are being pushed out is insane considering how good the production quality is, earned a new sub 👍

    • @Kalidor99
      @Kalidor99 Před měsícem

      That's easy, their main channel which has now 400 videos is in German, "Simplicissimus", they just have to translate the old videos to English.

  • @lyndestructible7088
    @lyndestructible7088 Před měsícem +506

    The animations just keep getting better with every video! This looks incredible, keep up the good and informative work.

  • @FreeBoy.
    @FreeBoy. Před měsícem +543

    You know its an awesome day, week, and a month overall, when fern uploads.

    • @xTombou
      @xTombou Před měsícem +9

      so every week and therefore every day is awesome? nice

    • @Oliver-ll6pn
      @Oliver-ll6pn Před měsícem +2

      I’d agree

    • @MrBorisRoblox
      @MrBorisRoblox Před měsícem

      hop out of the comments nerd

    • @mac_attack_zach
      @mac_attack_zach Před měsícem +2

      stop glazing

    • @user-bi3oc2jt4t
      @user-bi3oc2jt4t Před měsícem

      He uploads like every week. You can’t even make a comment you stole funny🤦

  • @DomsYouTube
    @DomsYouTube Před měsícem +347

    I really like this dot projection style animation

    • @EEEEEEEE
      @EEEEEEEE Před měsícem +2

      E‎ ‎

    • @lordbeetrot
      @lordbeetrot Před měsícem +2

      Agree

    • @EdvinLu
      @EdvinLu Před měsícem +1

      Is that the actual name of this animation style?

    • @d.6786
      @d.6786 Před měsícem +2

      @@EdvinLuprojection dot style

    • @amanprasad139
      @amanprasad139 Před měsícem +4

      I hate it
      More of a pain in eyes, too much going on
      I like it smooth and clean
      And if there's some textures that will be great as well

  • @ailsakatona2415
    @ailsakatona2415 Před měsícem +13

    I love how every single object is made of tiny circles it’s so well done and a really interesting video!

  • @AlexW-
    @AlexW- Před měsícem +110

    Hitlers secret: A video camera always running in his pocket ... the camera operator never dies

    • @reprovedcandy
      @reprovedcandy Před měsícem +1

      video cameras didnt even exist back then silly

    • @AlexW-
      @AlexW- Před měsícem +17

      @@reprovedcandy don't know if meta joke or not
      But yes they did. Just a bit bigger

    • @gergelyhalasz9754
      @gergelyhalasz9754 Před měsícem +7

      ​@@reprovedcandy Not true! The very first video camera was created in 1888, 55-57 years prior than these events.

  • @nursepls4110
    @nursepls4110 Před měsícem +344

    PLEASE put actual captions on your videos. The auto generated ones are impossible to use, and your videos are too damn good to miss

    • @MrBaumGeo
      @MrBaumGeo Před měsícem +25

      yeah i agree, its kinda hard for deaf people to view otherwise aswell

    • @MrBaumGeo
      @MrBaumGeo Před měsícem +2

      and i dont mean insane assylum in an offensive way but just so you can imagine because back then it was totally different from a Psychiatric hospitals. they treated people exremely poor

    • @poorsvids4738
      @poorsvids4738 Před měsícem +22

      @@MrBaumGeo what

    • @whoever_81
      @whoever_81 Před měsícem +3

      Auto generated ones seem pretty good to me!

    • @MrBaumGeo
      @MrBaumGeo Před měsícem +26

      ​@@poorsvids4738 bro my other comment against nzis was deleted so therefore the context was too. wtf youtube...

  • @HistoryOnPaper
    @HistoryOnPaper Před měsícem +40

    1:41 subtitle: “Tesco’s turning point”
    I think that’s the funniest subtitle ever

    • @will2056
      @will2056 Před měsícem +6

      This moment led to the 2013 invasion of Denmark.

    • @vijay-jw8gq
      @vijay-jw8gq Před měsícem +2

      No more meal deals😢

  • @marcop.3423
    @marcop.3423 Před měsícem +3828

    Posting this after the Trump video is insane

    • @juleha2693
      @juleha2693 Před měsícem +146

      Why?

    • @叵
      @叵 Před měsícem +19

      😂

    • @nathandebusschere7259
      @nathandebusschere7259 Před měsícem +485

      Bro dropped the prequel 😭

    • @HerrZikaPavlovic
      @HerrZikaPavlovic Před měsícem +504

      Yesterday was the 80th anniversary of the most well known assassination attempts on him in history, that's probably why.

    • @nickxplore4265
      @nickxplore4265 Před měsícem +115

      It's gonna make sense in 10 years 🤣

  • @Max-ln1du
    @Max-ln1du Před měsícem +12

    Can't tell you how thankful i am for this channel that you 3 created. I came from simpli and moved also a few years prior to the netherlands. This is such a great channel aswell as arte, displaying what the connection of two countrys can do. ❤

  • @NickHammer99
    @NickHammer99 Před měsícem +10

    You guys have such a good channel. The production value is insane and every episode is captivating. Great job

    • @benitogarcia5069
      @benitogarcia5069 Před 29 dny

      Personally this dudes voice isn’t really intriguing like the other lol

  • @samtg7507
    @samtg7507 Před měsícem +16

    The peak Documentary that you won't find in Netflix and it's for free hats off.

  • @Ismail-es2ld
    @Ismail-es2ld Před měsícem +11

    It makes so much sense now how you compiled your last video so fast! Having this video in the works came in clutch

  • @hans7856
    @hans7856 Před měsícem +11

    You failed to mention that Stauffenberg's briefcase was also moved, and a thick table leg protected Hitler from the blast.

  • @user-jw5lj9wu2g
    @user-jw5lj9wu2g Před měsícem +5

    Ist halt schon krass wie stark ihr die Reichweite erhöhen konntet und halt die Qualität massiv verbessert, keep doing

  • @1oxin
    @1oxin Před měsícem +129

    6:07 just to think if the allies didnt bomb, the war wouldve been over a lot quicker 💀

  • @christianc8453
    @christianc8453 Před měsícem +6

    It’s really wild what you can uncover about history when you teach yourself.
    “History is written by the victors.”

  • @_WyngX
    @_WyngX Před měsícem +15

    Wow fern.. your animation just gets better and better every video.. I'm jealous! :D

    • @rulers8969
      @rulers8969 Před měsícem

      I'm the first person to comment on you channel.

    • @_WyngX
      @_WyngX Před měsícem

      @@rulers8969 HEy mate! :D

    • @rulers8969
      @rulers8969 Před měsícem

      @@_WyngX hi brother

    • @rulers8969
      @rulers8969 Před měsícem

      @@_WyngX I sub to you.

  • @busterrex7588
    @busterrex7588 Před měsícem +9

    Fern, your videos are too amazing. From when I first clicked on the Whittinoom video I have been hooked on this channel you guys somehow are able to produce such great quality videos whist still uploading consistency and often! Just wanted to say I appreciate the effort that goes into these videos. Cheers

  • @Colmath
    @Colmath Před měsícem +39

    There is an argument to be made that him being alive actually made the war shorter. His involvement in military command from 1941 was so disastrous, so incompetent that it made huge Allied advances possible. Had he been assassinated and the German military been left to "do its job", they might have been able to hold out for longer. So in a weird way, the most evil dictator not dieing soon enough might have actually lead to fewer deaths than him becoming a martyr and even worse people coming to power.

    • @MacenW
      @MacenW Před měsícem +2

      Weird take

    • @boneman5569
      @boneman5569 Před měsícem +3

      @@MacenWweird but definitely reasonable

    • @shidditiddis
      @shidditiddis Před 19 dny

      Everything happened as it was supposed to

  • @saacde
    @saacde Před měsícem +5

    Fern keeps on dropping banger after banger this whole month?! Thank you for all the content

  • @--AnonymousUser--
    @--AnonymousUser-- Před měsícem +30

    0:10 You made a mistake here. That's the Bunker-Hitler outfit from Spring 1945, not the Chancellor outfit from late 1939.

  • @tobiwan001
    @tobiwan001 Před měsícem +5

    10:33 it’s the Bendlerblock (not Blenderblock). It was a city block in Bendlerstrasse. Now the street is called Stauffenbergstrasse - obviously.

  • @eternalslumber2k6
    @eternalslumber2k6 Před měsícem +6

    Keep this video quality up and keep covering such interesting subjects and you will become one of the most popular channels on this platform for sure.

  • @Clock_Man_2763
    @Clock_Man_2763 Před měsícem +4

    Two assassination videos in less than a week is crazy, Fern really cooks well 🔥🔥

  • @thePaloo
    @thePaloo Před měsícem +7

    Your storytelling is incredible and documentary-level. Many thanks for this video!

  • @5upl1an
    @5upl1an Před měsícem +150

    Its easy, someone wrote his name in a Death Note with the date 30. April 1945 which made him pratically immortal until that day.

    • @goblincomic4522
      @goblincomic4522 Před měsícem +5

      I though maximum day for death note is 23 days ?

    • @looniemoonie5955
      @looniemoonie5955 Před měsícem +9

      @@goblincomic4522 yes. It's just a joke. I don't remember if it's 23 days, I thought it was around 28

    • @obnoxious_moron
      @obnoxious_moron Před měsícem

      you can't extend someone's life with the death note

  • @Apfelloch
    @Apfelloch Před měsícem +25

    I really like this "point cloud" style animation and the transitions. Probably saves a lot of time in comparison to actual walking animations. However, all these little dots are pretty hefty on CZcamss compression algorithm such that some scenes become blurry. Tom Scott has a great video about this ("Why Snow and Confetti Ruin CZcams Video Quality").

  • @Brandonlandis
    @Brandonlandis Před měsícem +45

    the worst dude in history has the most luck and i cant even win $10 on a scratch off lottery ticket

    • @Dr.W.Krueger
      @Dr.W.Krueger Před 27 dny +2

      There were far greater butchers throughout history

    • @Nippleless_Cage
      @Nippleless_Cage Před 18 dny +1

      Not with Hitler's level of sophistication and premeditation. ​@@Dr.W.Krueger

  • @BrendanLorenzo
    @BrendanLorenzo Před měsícem +2

    The aesthetic of the animation is so unique and lends itself beautifully to the storytelling 👌

  • @rahmi.digital
    @rahmi.digital Před měsícem +6

    Unglaubliches Timing und unfassbar gut umgesetzt. Hut ab vor dem gesamten Team!

  • @rjbeatz
    @rjbeatz Před měsícem +281

    The irony is that he ended up killing himself after all the attempts 💀

    • @mrbilter83
      @mrbilter83 Před měsícem +53

      "Fine i'll do it myself" - funny mustache man, 1945 -

    • @the_mastermage
      @the_mastermage Před měsícem +4

      He be like fine I'll do it myself

    • @user-td2jw9ze2c
      @user-td2jw9ze2c Před měsícem +14

      He ran to South America

    • @mariopasta
      @mariopasta Před měsícem +5

      Or maybe not

    • @shashwatgrover1
      @shashwatgrover1 Před měsícem +2

      Maybe they would have said that Trump also did it himself 🤷🏻‍♂️

  • @LG23-ho3zk
    @LG23-ho3zk Před měsícem +498

    Hitler is the real life stupid comically evil villain that the franchise keeps on reviving
    Edit: dawg this pfp is satire, I ain’t actually ancap

  • @realpv_aka_vp
    @realpv_aka_vp Před měsícem +2

    Despite the fact that i know that its a coincidence, this video's timing is the funniest thing I've seen in a while
    even though other people, including the creators, might disagree, this is kinda meaningful as well

  • @Jonathan_drg
    @Jonathan_drg Před měsícem +1

    Ihr übertrefft euch mit den Videos mittlerweile selbst! Die Animationen sind 💯💯

  • @striderwhiston9897
    @striderwhiston9897 Před měsícem +8

    This artstyle of yours kinda reminds me of those war flashback cutscenes in call of duty ghosts.

  • @Alex-rn6rr
    @Alex-rn6rr Před měsícem +19

    Cant wait to watch this on Simplicissimus

  • @Turkishgameinvader
    @Turkishgameinvader Před měsícem +7

    That bastard survived 43 assasinations dude he has some kind of plot armor

  • @PushyPawn
    @PushyPawn Před měsícem +2

    You guys put so much work into your animation that in 4K, I swear I can see individual molecules and atoms! 👏

  • @ashtonalexander8760
    @ashtonalexander8760 Před měsícem

    Channels like yours are great for the mass of people who don’t know the history of such things as well as WW2 and history enthusiasts like myself.
    I’d love to see your take on the the events of Operation Anthropoid. The general public knows so little of these great stories of valor and courage.

  • @ericayoo5101
    @ericayoo5101 Před měsícem +14

    Hitler’s survival tells us how persistent Satan reigns until the end. This is really frustrating.

  • @moonmelo_rocket2636
    @moonmelo_rocket2636 Před měsícem +3

    Welcome back german comentator, missed you

  • @just_mdd4
    @just_mdd4 Před měsícem +52

    Fern must've planned these videos! 😝

    • @just_mdd4
      @just_mdd4 Před měsícem +27

      Disclaimer: Yes, I know the timing was not intentional.

    • @Paradoxical124
      @Paradoxical124 Před měsícem +2

      @@just_mdd4why make the comment then 🤦‍♂️

    • @Hyperlaser_Merc
      @Hyperlaser_Merc Před měsícem +3

      Its funny, ​@@Paradoxical124

    • @Paradoxical124
      @Paradoxical124 Před měsícem

      @@Hyperlaser_Merc I suppose that’s my issue because I didn’t laugh 😞

    • @ftr98
      @ftr98 Před měsícem +3

      Yes because yesterday was the 80'th anniversary of the stauffenberg attentat

  • @anasqai
    @anasqai Před 23 hodinami

    If it's inside a vase, maybe easily if long distance stethoscope if can hear ticks to vases that's safe to walk(due to the scheduled moment), vase pattern looks easy to remember. Means somehow they break vase and place the bomb after that, means their wire is taken out after vase breaks to hide how it looks like(the before-defuser moment to think of wire to cut).

  • @Housewarmin
    @Housewarmin Před měsícem +2

    It is music to my ears to hear you say these names properly. I love your accent

  • @Cypher791
    @Cypher791 Před měsícem +3

    They don’t make tables like that anymore… ✋😆

  • @dhavalshah2612
    @dhavalshah2612 Před měsícem +22

    babe wake up, new Fern video dropped.

  • @Lt_Koro
    @Lt_Koro Před měsícem +36

    I was gonna comment on how this video after the trump video is weird, but pushing the trump video out as quickly as possibly was just important and yesterday was the 80th anniversary of this event, so it really cant be malicious in any way.

  • @orfoisus
    @orfoisus Před měsícem +1

    Damn! Brilliant really spent A TON on this recent youtube-wide ad-spree

  • @johannesr8709
    @johannesr8709 Před měsícem +1

    The dust visuals and animations are absolutely insane ! Amazing work!

  • @foudie
    @foudie Před měsícem +35

    i mean they could've just put the other unarmed bomb with the armed bomb in the brief case, so when the first bomb explodes the other one would too.

    • @grimnippz7398
      @grimnippz7398 Před měsícem +11

      depends on the explosive used, it could have just blown the second bomb apart failing too detonate.

    • @Marcel-yu2fw
      @Marcel-yu2fw Před měsícem +3

      @@grimnippz7398 But it couldn't hurt to put in the other bomb too, right? Just in case it works.

    • @hwfq34fajw9foiffawdiufhuaiwfhw
      @hwfq34fajw9foiffawdiufhuaiwfhw Před měsícem

      not that i have knowledge of bomb making, but that would likely just shatter the other bomb into shrapnel like it was any other object in the blast radius. wouldn't be the same as a second bomb
      exploding (overheated) soda can vs firing a bullet through a soda can

    • @cuboidmelon
      @cuboidmelon Před měsícem +2

      If it was minecraft, then yeah...

    • @grimnippz7398
      @grimnippz7398 Před měsícem

      The explosives used required a chemical reaction for the detonation, meaning the pressure of the second bomb would have had almost no chance too undergo detonation. However as a redundancy it couldnt have hurt.

  • @0h5ive
    @0h5ive Před měsícem +3

    holy shit he still alive?!

  • @Kaanooo
    @Kaanooo Před měsícem +1

    Ich frage mich immer wie solche Videos entstehen. Also ernsthaft, wie funktioniert die Animaton der Videos? Wie werden die Themen rausgesucht ? Man merkt das viel Mühe und Arbeit reingesteckt wird und deswegen schaue ich sie mir auch gerne an.

    • @skorp5677
      @skorp5677 Před měsícem

      Simpli haben halt inzwischen ne recht große Redaktion. Auf dem Kanal gab es glaube ich auch mal irgendwann ein Video zum Entstehungsprozess. Vielleicht auch auf 2BG

    • @Kaanooo
      @Kaanooo Před měsícem

      @@skorp5677 ah ok, danke für die antwort.

  • @mariusbcc7391
    @mariusbcc7391 Před měsícem +2

    How is this the first time I saw this channel its so good + the sources this needs more views.

  • @timr.2257
    @timr.2257 Před měsícem +9

    1: Aren’t there better methods back then than relying on chemicals for a time bomb? 😅
    2: They don’t even pat down new people that gets close to Hitler?

    • @concept5631
      @concept5631 Před 28 dny

      Nazi's aren't known for being smart.

  • @marianandnorbert
    @marianandnorbert Před měsícem +17

    HE CAN'T KEEP GETTING AWAY WITH IT

    • @g3nj1
      @g3nj1 Před měsícem

      The tried to put Adolf in a self defense situation and found out.

  • @Bloidz7
    @Bloidz7 Před měsícem +7

    Fern is on his assassination video arc

  • @dragonite87140
    @dragonite87140 Před měsícem +1

    2 assassination attempt videos from Fern in a week is crazy

  • @marksantiago9841
    @marksantiago9841 Před měsícem +2

    I think you missed something. The briefcase was placed near hitler, but it was moved by heinz brandt because it was in his way.

  • @rostislav.lisovy
    @rostislav.lisovy Před měsícem +50

    Ok... so showing all those explosions, talking about killing someone, showing human figures with grenades in their pockets and explaining they would have also killed themselves is ok... but for some reason you have to "censor" the word "suicide"?

    • @myaccount__7269
      @myaccount__7269 Před měsícem +36

      Blame CZcams who de mometizes bad words

    • @jakedee4117
      @jakedee4117 Před měsícem +5

      I thought the same thing myself, but it's CZcams rules, and perhaps censored automatically by algorithm not by a human who understands the full subject matter. I recently have heard CZcamsrs saying, "He un-alive himself!"

    • @ergwertgesrthehwehwejwe
      @ergwertgesrthehwehwejwe Před měsícem +2

      At what point do we stop forgiving youtubers for bending the knee to censorship like this? Nobody seems to have a spine anymore

    • @myaccount__7269
      @myaccount__7269 Před měsícem +24

      @@ergwertgesrthehwehwejwe it’s either this or they get zero money. Do you work for free? As I said…blame CZcams

    • @keisuketakahasi4584
      @keisuketakahasi4584 Před měsícem

      @@myaccount__7269 dont hate the player, hate the game

  • @DiplexHeated
    @DiplexHeated Před měsícem +27

    The people who think it’s crazy dropping this after the Trump video are the ones associating Trump with Hitler, not the channel.

    • @mao-tse-tung-games
      @mao-tse-tung-games Před měsícem +2

      It wasn't planned, but when it happened, they grabbed the opportunity. Truly a deficit of respect

    • @BlackoutWH
      @BlackoutWH Před měsícem +15

      @@mao-tse-tung-games Or maybe it was the 80th anniversary of the attempt mhhh.... nahh they just grabbed the opportunity

    • @Stijn5
      @Stijn5 Před měsícem +13

      @@mao-tse-tung-games Boohoohoo. The orange sociopath is impossible to respect.

    • @johnnyxmusic
      @johnnyxmusic Před měsícem

      @@Stijn5 you know it’s fantastic… Powered by the right AI algorithm… Every disparaging comment about a certain person could probably be collected in one afternoon… And go on a certain persons list… A certain person who is planning on creating concentration camps… And when the people in those concentration camps are emptied out… They’ll be plenty of room for people who don’t go along with the agenda of that certain person. I believe the camps in Germany at least one of them were created As rehabilitation camps. That’s the one that has a certain phrase over the gateway…

    • @micahsarm
      @micahsarm Před měsícem +3

      @@mao-tse-tung-games Respect should be given to those who deserve it, not to those like Trumpie.

  • @JollyBubuyug
    @JollyBubuyug Před měsícem +5

    The fact he got away from all of those assassinations but not the assassination from himself.

  • @Qba116
    @Qba116 Před měsícem

    Love that you included (or maybe "excluded") Stauffenberg's missing right hand!

  • @nyfex4190
    @nyfex4190 Před měsícem +1

    Jonas is the perfect speaker for this topic, since there are so many notable German personalities in those happenings

  • @vincent-of7vo
    @vincent-of7vo Před měsícem +17

    Today, we remember Claus schenk Graf von stauffenberg🕊️

  • @nelo1453
    @nelo1453 Před měsícem +3

    Ungewöhnlich Euch auf Englisch zu gucken wenn man nur Simplicissimus gewohnt ist

  • @lukemontgomery1774
    @lukemontgomery1774 Před měsícem +54

    You'd think after 40 attempts he'd take the hint

    • @alphakevin687
      @alphakevin687 Před měsícem

      Fascists are not the smartest bunch

    • @antdiamond64
      @antdiamond64 Před měsícem +10

      He did

    • @Willy_Tepes
      @Willy_Tepes Před měsícem +1

      That the hand of God was protecting him?

    • @user-gi7vi9gm4t
      @user-gi7vi9gm4t Před měsícem

      @@Willy_Tepes if god was mean : , no it has to be a coincidence

    • @Willy_Tepes
      @Willy_Tepes Před měsícem +1

      @@user-gi7vi9gm4t God takes care of his servants..

  • @oowena
    @oowena Před měsícem +1

    everything abt your channel is amazing you upload frequently and the animation is just amazing and so is the story telling keep up the great work

  • @mystischertelefant8868
    @mystischertelefant8868 Před měsícem

    Perhaps also interesting: the actual assassination attempt, which Staufenberg had carried out that day, was postponed again shortly beforehand, to the “Wolf's Lair” away from the actual venue. This also had an enormous influence on the outcome of the situation, as the oak table was able to absorb the pressure of the detonation and the open windows were also able to release the pressure into the surrounding area. The meeting was actually planned in a bunker, where the pressure would have further damaged the room and caused more damage. This was also one of his strategies, canceling or changing locations or times at short notice.

  • @GeorgeNoah-xf9tb
    @GeorgeNoah-xf9tb Před měsícem +155

    Hallelujah 🙌🏻!!!!! The daily jesus devotional has been a huge part of my transformation, God is good 🙌🏻🙌🏻. I was owing a loan of $49,000 to the bank for my son's brain surgery, Now I'm no longer in debt after I invested $11,000 and got my payout of $290,500 every month…God bless Mrs Susan Jane Christy ❤️

    • @PoynterGeesey
      @PoynterGeesey Před měsícem

      Hello!! how do you make such monthly, I’m a born Christian and sometimes I feel so down of myself 😭 because of low finance but I still believe God

    • @NoahOliver-rx3mp
      @NoahOliver-rx3mp Před měsícem

      Thanks to my co-worker (Carson ) who suggested Ms Susan Jane Christy

    • @KleffmanRosenbush
      @KleffmanRosenbush Před měsícem

      She's a licensed broker here in the states🇺🇸 and finance advisor.

    • @KleffmanRosenbush
      @KleffmanRosenbush Před měsícem

      After I raised up to 525k trading with her I bought a new House and a car here in the states🇺🇸🇺🇸 also paid for my son's surgery….Glory to God, shalom.

    • @LouisPeters-fw9cg
      @LouisPeters-fw9cg Před měsícem

      Can I also do it??? My life is facing lots of challenges lately

  • @Mightydoggo
    @Mightydoggo Před měsícem +5

    Haha! The timing is just glorious, I think the universe wants to tell us something. lol
    And yeah, every halfway sane person knows how long it takes for such a video to make. It´s a coincidence, but a really funny one.

    • @nikoraasu6929
      @nikoraasu6929 Před měsícem

      timing on what

    • @mao-tse-tung-games
      @mao-tse-tung-games Před měsícem

      Nah. They had been working for a while, sure, but they get to decide when it uploads. It's not a mere "coincidence". It's their strategy of getting the algorithm on their side. And they got it.

    • @BlackoutWH
      @BlackoutWH Před měsícem

      ​@@mao-tse-tung-gamessure it's not like the most famous attempt in the video had its anniversary the day before it got released

  • @TheOGRokma
    @TheOGRokma Před měsícem +3

    Odd coincidence of when this video came out🤔

  • @kanjiking
    @kanjiking Před měsícem

    The quality of your animations has become just insane. Love your work.

  • @udiniali
    @udiniali Před měsícem +1

    the production level is crazy

  • @hanibalfischkopf6286
    @hanibalfischkopf6286 Před měsícem +8

    Hitler put all his skill points in luck.

  • @ShowCasesGD
    @ShowCasesGD Před měsícem +22

    SHUT UP MOM FERN UPLOADED

  • @TheCommentor-
    @TheCommentor- Před měsícem +4

    Hitler has so much plot armour, he was the only person that could kill Hitler

  • @Nobody.exe50
    @Nobody.exe50 Před 25 dny

    the production value of this is amazing

  • @chasemcm
    @chasemcm Před měsícem +1

    Most of you are too young to know good films. But you should watch these 4 fantastic ww2 films. One which is specifically about this topic, called “Valkyrie” , another great one is “The Pianist”, or “the boy in the striped pajamas” or of course the most famous “saving private ryan”
    All amazing films.

  • @sleepingmelons8420
    @sleepingmelons8420 Před měsícem +2

    Why is CZcams posting Wikipedia articles.

  • @DoFliesCallUsWalks
    @DoFliesCallUsWalks Před měsícem +4

    fern is on an Assassination streak.

  • @ConsumerOfCringe
    @ConsumerOfCringe Před měsícem +5

    "guys lets not critisize hitler, they nearly assassinated him, we need unity in germany"

  • @f1nTiVR
    @f1nTiVR Před měsícem

    The amount of skill that goes into these animations is crazy and I know because of experience

  • @NeobanditRS3
    @NeobanditRS3 Před měsícem +1

    i guess this is a good time to remember history in a weird twisted way. ty algorithm

  • @espanolbeef2901
    @espanolbeef2901 Před měsícem +5

    12:10 not as if millions more people of other religions, ethnicities and those with disabilities weren’t killed as a result of his policies and the German war effort. Why would only one group of people be highlighted if they were only a fraction of the total casualties of the war?

  • @heroofjapan
    @heroofjapan Před měsícem +9

    The timing to post this video is sus