Darknet OPSEC Bible 2022 Edition

Sdílet
Vložit
  • čas přidán 26. 05. 2022
  • ₿💰💵💲Help Support the Channel by Donating Crypto💲💵💰₿
    Monero
    45F2bNHVcRzXVBsvZ5giyvKGAgm6LFhMsjUUVPTEtdgJJ5SNyxzSNUmFSBR5qCCWLpjiUjYMkmZoX9b3cChNjvxR7kvh436
    Bitcoin
    3MMKHXPQrGHEsmdHaAGD59FWhKFGeUsAxV
    Ethereum
    0xeA4DA3F9BAb091Eb86921CA6E41712438f4E5079
    Litecoin
    MBfrxLJMuw26hbVi2MjCVDFkkExz8rYvUF
    Dash
    Xh9PXPEy5RoLJgFDGYCDjrbXdjshMaYerz
    Zcash
    t1aWtU5SBpxuUWBSwDKy4gTkT2T1ZwtFvrr
    Chainlink
    0x0f7f21D267d2C9dbae17fd8c20012eFEA3678F14
    Bitcoin Cash
    qz2st00dtu9e79zrq5wshsgaxsjw299n7c69th8ryp
    Etherum Classic
    0xeA641e59913960f578ad39A6B4d02051A5556BfC
    USD Coin
    0x0B045f743A693b225630862a3464B52fefE79FdB
    Subscribe to my CZcams channel goo.gl/9U10Wz
    and be sure to click that notification bell so you know when new videos are released.
  • Věda a technologie

Komentáře • 1,1K

  • @rpeetz
    @rpeetz Před 2 lety +1675

    You know what defeats strong full disk encryption? $5 wrench hitting you until you unlock it.

    • @rajasekharareddy4584
      @rajasekharareddy4584 Před 2 lety +132

      Classic and effective 👏👏👏. 😂😂😂

    • @YerBrwnDogAteMyRabit
      @YerBrwnDogAteMyRabit Před 2 lety +359

      Rocks are free. Save the $5 for a latte.

    • @ireallyreallyreallylikethisimg
      @ireallyreallyreallylikethisimg Před 2 lety +82

      A hotkey to zero write ;)

    • @spamlogs2701
      @spamlogs2701 Před 2 lety +97

      Killswitch big brain play

    • @ArthursHD
      @ArthursHD Před 2 lety +55

      If it automatically boots like Windows you can deprive it from updates and reverse shell into it with a known exploit. Completely bypassing encryption :D In that way LVS and VeraCrypt is better than BitLocker standard implantation.
      Quickest wipe is to blow up NAND chip in seconds. Could also modify the package and fry it with an electric ⚡ arc 😄

  • @Action2me
    @Action2me Před 2 lety +1066

    “And it’s really popular on dread”
    7 upvotes

  • @sethh9550
    @sethh9550 Před 2 lety +2883

    Mental Outlaw please never stop making videos, im going to college for comp sci next you and you are a HUGE inspiration. Keep up all the content even workout/meal vids all amazing.

    • @MentalOutlaw
      @MentalOutlaw  Před 2 lety +792

      Thanks, good luck with your classes and remember to network!

    • @bubbleboy821
      @bubbleboy821 Před 2 lety +52

      The real value of college

    • @J43rv1
      @J43rv1 Před 2 lety +66

      Stay woke, avoid college, get certs and xp instead - it's the MO way

    • @newtonbomb
      @newtonbomb Před 2 lety +33

      @@phillipanselmo8540 I'll tell you what, my local state university comp sci/engineering department sure was a pretty garbage experience...

    • @J43rv1
      @J43rv1 Před 2 lety +30

      @@phillipanselmo8540 I'm not saying I agree but Mental Outlaw made a video about this exact problem, in case OP hasn't seen it

  • @WarLordN1k
    @WarLordN1k Před 2 lety +367

    USPS tracking normal packages with tor sounds like my kind of trolling.

    • @nothing_
      @nothing_ Před 2 lety +15

      It sure does.

    • @meganlettiere4386
      @meganlettiere4386 Před 2 lety +6

      ikr

    • @eac-ox2ly
      @eac-ox2ly Před 2 lety +102

      Imagine if someone made a bot to somehow retrieve tens of thousands of USPS tracking numbers and then automatically looked them up with tor. That would be some fancy obfuscation.

    • @WarLordN1k
      @WarLordN1k Před 2 lety +43

      @@eac-ox2ly I think you have a wonderful idea right there.

    • @eac-ox2ly
      @eac-ox2ly Před 2 lety +5

      @@WarLordN1k 😈

  • @quiteafancyemerald
    @quiteafancyemerald Před 2 lety +1099

    I just love how informative this is. Not like I would do anything ever related to this but keep making unique interesting content :)

    • @vsnusv7555
      @vsnusv7555 Před 2 lety +82

      surely

    • @TheSuperBoyProject
      @TheSuperBoyProject Před 2 lety +101

      Oh, I would never *wink* *wink*

    • @hanabiilesley
      @hanabiilesley Před 2 lety +13

      i mean, either you initially create really informative recourse, or don't even attempt since even smallest mistake could cause smb huge problems

    • @yallugly4317
      @yallugly4317 Před 2 lety +4

      I certainly do lol gotta love the vendors

    • @Riftio617
      @Riftio617 Před rokem +3

      thats what they all say

  • @midimusicforever
    @midimusicforever Před 2 lety +81

    What's needed and what's not depends on the threat model. Always start there!

  • @crabbyboi9127
    @crabbyboi9127 Před 2 lety +91

    i feel like just watching these vids have put me on a government watch-list

    • @andybuscus383
      @andybuscus383 Před rokem +8

      Guess you just gotta follow these steps so the government can't watch you anymore.

    • @jer1776
      @jer1776 Před rokem +11

      Same lol, Im just an IT Networking/Cybersecurity major who finds this stuff fascinating. Wouldnt pass up working for the Feds if I had the chance.

    • @crabbyboi9127
      @crabbyboi9127 Před rokem +8

      @@jer1776 ha ha yes me too ha ha (are the feds gone yet?)

    • @Conorscorner
      @Conorscorner Před měsícem +1

      ​@@jer1776uh huh, Sounds like a carefully crafted alibi that a Super Dark Net Hacker Lord would say.

    • @Conorscorner
      @Conorscorner Před měsícem

      ​@@crabbyboi9127Of course, we're too busy going after politicians, the mega wealthy and corporations to pay attention to unimportant stuff on here.

  • @catcatcatcatcatcatcatcatcatca

    Wrapping packages in tinfoil in public bathrooms seems disturbing enough to make people notice and possibly call the police. It’s kind of like wearing a mask when picking up the package: sure it inconveniences any law enforcement tracking the package, but it also alerts the normal law enforcement of possible robbery…

    • @julianbinder2371
      @julianbinder2371 Před 2 lety

      luckily there's covid masks now, just make sure to look like a liberal If you live in a very conservative area where a mask would be unusual

    • @ArthursHD
      @ArthursHD Před 2 lety +4

      There are silicon masks 😷 that look like $ex doll faces 😄
      Pretty realistic if you ask me. :)

    • @meganlettiere4386
      @meganlettiere4386 Před 2 lety +65

      Wearing a mask is normal nowadays because of the pandemic, actually.

    • @a_wild_Kirillian
      @a_wild_Kirillian Před 2 lety +8

      There are cabins in public bathrooms, you know.

    • @meganlettiere4386
      @meganlettiere4386 Před 2 lety

      @@a_wild_Kirillian what do you mean?

  • @olivialambert4124
    @olivialambert4124 Před 2 lety +102

    I think its incredibly interesting to learn about. But personally I just eat my bugs and live in my pod. I can't deal with the hassle this entails. But god bless you guys fighting the good fight to avoid mass surveillance and huge governmental overreach.

    • @eac-ox2ly
      @eac-ox2ly Před 2 lety +17

      This made me cackle. Thanks.

    • @olivialambert4124
      @olivialambert4124 Před 2 lety +22

      @Zero One I'd like to hope so too. Perhaps if I search some naughty words I might get my own NSA friend. I do wish he reached out for a chat over covid though, it might have made both me and my agent a little less lonely over that year. Hopefully he likes computer games. I can get my very own government mandated stream viewer without even paying for big follows.

    • @damazywlodarczyk
      @damazywlodarczyk Před 11 měsíci

      @@olivialambert4124 what kind of bullshit is this

  • @aZebruh
    @aZebruh Před 2 lety +491

    “Yes officer unfortunately that $100k in bitcoin was lost in a boating accident :(“
    Edit: If you liked my comment, also like the video, cause its really his joke not mine😉

    • @chrishears
      @chrishears Před 2 lety +78

      Catfish got it bruh.

    • @mrbanana6464
      @mrbanana6464 Před 2 lety +19

      You can have the greatest opsec in the world but mysterious crypto transactions, especially in large amounts, won't be getting past the IRS. Always pay your taxes.

    • @Cookiekeks
      @Cookiekeks Před 2 lety +79

      @@mrbanana6464 Not even the IRS can track monero transactions

    • @joey199412
      @joey199412 Před 2 lety

      @@mrbanana6464 IRS put a seething bounty on cracking Monero because they actually can't track it.

    • @mathisblair2798
      @mathisblair2798 Před 2 lety +13

      @GENDER EQUALITY IS A MYTH tis why I never set foot in the ocean. We evolved from sea to land not vice versa I say.

  • @delchodimitrov9439
    @delchodimitrov9439 Před 2 lety +161

    "Don't talk about Dark Web in public!"
    -- Mental Outlaw
    :~70% of his vids - talking about things related to the dark web -- Mental Again :D

    • @blackninja9400
      @blackninja9400 Před 2 lety

      We suspecting this channel is some honeypot for feds. Why? Why Google allow this on CZcams?

    • @kim-hendrikmerk4163
      @kim-hendrikmerk4163 Před 2 lety +39

      Means he probably isn't using it. Or he has some mind boggling strategy that we are too simple to understand.

    • @wontcreep
      @wontcreep Před 2 lety +11

      the technique is to only talk about things you don't REALLY do :))) and shutting up about the spice

    • @egarcia1360
      @egarcia1360 Před 2 lety +15

      As in, don't talk about your dark web activities in public because you could incriminate yourself. His content is just for educational purposes ;)

    • @e3.14c4
      @e3.14c4 Před 2 lety +6

      Not what that's supposed to mean. Like if you go watch an illegal boxing match (if those still exist, or ever existed on the internet, just pulling an example out of fiction to stay pg), and then tell all of your buddies you saw someone get their face tore open by brass knuckles. Every piece of information you emit, is a liability.

  • @fancywaifu9821
    @fancywaifu9821 Před 2 lety +201

    I’m going into college next year for computer science and cybersecurity. I’ve already been studying in these fields for a while now. The more I learn about cybersecurity, the more I want to take more action in my life to make my life private and secure. Your a big inspiration mental outlaw!

    • @mineis3andhalfinches865
      @mineis3andhalfinches865 Před 2 lety +13

      I hope you succeed, cybersecurity is cool as hell. Im currently saving to take courses for networking and kali linux. mental outlaw got me into this after watching his vid about mcafee getting shwacked a year ago

    • @fancywaifu9821
      @fancywaifu9821 Před 2 lety +4

      @@mineis3andhalfinches865 Definitely a good field to get into!

    • @whannabi
      @whannabi Před 2 lety +1

      My man's gotta get big money

    • @Concise_Parakeet
      @Concise_Parakeet Před 2 lety +1

      @@whannabi lmao

    • @imonjenkem
      @imonjenkem Před rokem +1

      going into college but cant use the proper youre form kek

  • @yb7875
    @yb7875 Před 2 lety +190

    Im glad this channel is getting more views. The more viewers this channel has, the less suspicious a person is for watching it, people are increasingly more likely to be normies instead of privacy nuts. Keep it up, been here for a while, and yours is better than the rest.

    • @yb7875
      @yb7875 Před 2 lety +6

      I know its not the sort of thing you usually do, but I looked up tutorials on yagi antennae wifi extension and its very lacking. It sure would be good if there was one on youtube, made by a reliable guy..

    • @mathisblair2798
      @mathisblair2798 Před 2 lety +5

      I have to give Denshi an honorable mention too now and again, perhaps for more recreational knowledge.

    • @richardlamm4826
      @richardlamm4826 Před rokem

      I've never been called a normie before.

  • @TIOLIOfficial
    @TIOLIOfficial Před rokem +70

    6:25 - As far as the Ross Ulbricht library situation, it wasn't that he was "trying to he a hero", as you once said". Here's what actually happened: two officers created a fight. When Ross was sitting in the library with his laptop, the agents knew they could not just rush him, cause he most likely would have just hit the kill switch. So what happened was that the 2 agents started a fake fight and when at one point when of them raised their voice, Ross turned around to look. Unfortunately, that split second of our natural reaction was all it took for a third one to grab the computer, while the others grabbed Ross himself.
    Ross didn't walk over to anyone, he didn't try to "play the hero", as you once said.

    • @donovantheghost4179
      @donovantheghost4179 Před 10 měsíci +4

      Use a laptop with out a charger. 😅

    • @stigcc
      @stigcc Před 3 měsíci +1

      If you have Tails with a string attached to your wrist and the usb drive, it would be a physical kill switch.

  • @s4ms3piol30
    @s4ms3piol30 Před 2 lety +630

    Hey Mental, I just wanted to say that I'm studying computer science at university and want to pursue a career in security, And your videos have been a tremendous help! Especially the way you simplify complex attacks in layman's terms, I'm surely going to credit you in my Graduation speech! Love ❤️

    • @fahimp3
      @fahimp3 Před 2 lety +53

      Or Mental could be a CIA honeypot... Just saying.
      Also I found "A Graduate Course in Applied Cryptography
      " by Dan Boneh and Victor Shoup very helpful in understanding the computer science side of things.
      It is available as a free pdf online.

    • @s4ms3piol30
      @s4ms3piol30 Před 2 lety +5

      @@fahimp3 thx

    • @Sombre____
      @Sombre____ Před 2 lety +5

      Advice : Don't buy Hak5 device. :)

    • @s4ms3piol30
      @s4ms3piol30 Před 2 lety

      @@Sombre____ i hate em anyways

    • @Sombre____
      @Sombre____ Před 2 lety

      @@s4ms3piol30 Good. Because it's script kiddies stuff or the best way to get caught. They resell opensource stuff in a shiny box with their name. They will be the first to snitch you if the feds ask them question.

  • @thegamefanaticshow
    @thegamefanaticshow Před 2 lety +10

    A fantastic method of physical security is to get a usb drive that can securely connect to a lanyard. Find a lanyard that can securely STAY wrapped around your wrist. Make sure lanyards long enough to use the laptop while securely connected to your person and USB drive. Tada now you got a dead man’s switch, at any time that machine is separated from you instawipe!

  • @jakdamkatnia5335
    @jakdamkatnia5335 Před 2 lety +71

    Always happy to see a mental outlaw post, i'm working on my cybersecurity certs, and you help keep me up to date on the latest security news and tips :)

  • @Jango1989
    @Jango1989 Před 2 lety +18

    "We're not going to discuss rugs" this took me a long minute😅🤣🤣

  • @KristophM
    @KristophM Před 2 lety +356

    You're a legend, Kenny! Over a decade ago I tried Ubuntu just for the hell of it and I hated it. But after finding your channel, you're the sole reason I ditched Windows and got into GNU/Linux again. And I've gone down the rabbit hole. Currently BTW I use Arch, lol 😎

    • @sirzorg5728
      @sirzorg5728 Před 2 lety +140

      How do you know who uses arch?
      They will tell you within 5 minutes of meeting you.

    • @mathisblair2798
      @mathisblair2798 Před 2 lety +24

      @@sirzorg5728 It's true, for you see, tis I, who also is an user of thee arch, verily.

    • @JamesWilson01
      @JamesWilson01 Před 2 lety +43

      @@sirzorg5728 Vegans too. They should do a study on the correlation of Arch usage to veganism. It would be a good use of public money.

    • @0xC47P1C3
      @0xC47P1C3 Před 2 lety +3

      Kung Fu Kenny at it again

    • @Gilbert2988
      @Gilbert2988 Před 2 lety +9

      how much do you weigh?

  • @bluegizmo1983
    @bluegizmo1983 Před rokem +50

    if your gonna take the package somewhere else to open it, write "return to sender" on the outside of the package immediately upon receiving it, so if they grab you as soon as you leave the house, your just taking it to the post office to return it as you didn't order anything.

    • @BrandonCurington1
      @BrandonCurington1 Před rokem +10

      thats actually genius

    • @Tor010
      @Tor010 Před rokem

      They never do that, they will just get you too sign on delivery and then let themselves be known,

  • @JamesWilson01
    @JamesWilson01 Před 2 lety +584

    Ah, Dread. Always a good wholesome read! Everything from security gods to insanely paranoid dudes trying to score their first gram to kids making death threats against hardcore criminals 🤣
    This "guide" went from some James Bond sh*t to the most stupidly obvious way to get phished. Nice job on pointing out the flaws 👍 Btw Tails doesn't come with a Monero wallet which made me think that could be the glow boys target no.1 for trojanizing the OS. Keep up the good work man!

    • @s4ms3piol30
      @s4ms3piol30 Před 2 lety +46

      the security gods on dread are really gods

    • @JamesWilson01
      @JamesWilson01 Před 2 lety +79

      @@s4ms3piol30 Worshipped daily by many tens of people 🤪

    • @KManAbout
      @KManAbout Před rokem +2

      Carcano > monaro

    • @KB-nt7eg
      @KB-nt7eg Před rokem +17

      @@KManAbout you mean cardano and monero? How broke are you? Lol

    • @KManAbout
      @KManAbout Před rokem +2

      @@KB-nt7eg smartphone keyboard broke

  • @benneilsen2915
    @benneilsen2915 Před 2 lety +35

    He makes a lot of points of not using your home WiFi, but if you want to protect your other devices, just segment it. If you're firewall-savvy you can make a separate subnet for risky devices and install strict host firewalls on them.

    • @S_Roach
      @S_Roach Před 2 lety +26

      There is a saying, "Don't S* where you eat." That's why you don't want to use your own WiFi. Turning logs off on your router won't matter if they already know your address was involved.

  • @azatecas
    @azatecas Před 2 lety +8

    i love your opsec videos, great balance of comedy and good advice.

  • @yourlocalcyborg
    @yourlocalcyborg Před 2 lety +43

    10/10 tutorial as always, my good man! Keep up the fantastic work

    • @thekeyboard11
      @thekeyboard11 Před 2 lety +2

      Yeah, 10/10 tutorial about getting darknet goods shipped to your house

    • @ArthursHD
      @ArthursHD Před 2 lety

      Tried to post a few things not mentioned, but CZcams keeps detting my comments :( Too sensitive :D
      Base64 encoded comment for the algorithm (:
      V2h5IHdvdWxkIFlvdXR1YmUgcmVtb3ZlIG15IGNvbW1lbnQ/CkJpcXVhZCB5YWdpIGlzIGEgbmljZSBoaWdoIGdhaW4gYW50ZW5uYS4KVXNlIHVuaXF1ZSBlbWFpbCBhZGRyZXNzZXMsIEFjY291bnQgbmFtZXMgZm9yIGVhY2ggYWNjb3VudC4gd2lsbHdoaXRlIC8gZnJlZW1haWwgb24gR2l0aHViIGhhcyBhIGxpc3Qgb2YgZnJlZSBlbWFpbCBzZXJ2ZXJzCklmIHlvdSBwb3N0IGNyeXB0byBhZGRyZXNzZXMgZG9uJ3QgcmV1c2UgdGhlbS4KSWYgeW91IHVwbG9hZCBwaG90b3Mgb3Igb3RoZXIgY29udGVudC4gUmVtb3ZlIHNlbnNpdGl2ZSBpbmZvIGFuZCByZW1vdmUgRVhJRiBkYXRhIGxvY2FsbHkgb24geW91ciBkZXZpY2UuCkRvbid0IGdldCB0b28gYmlnLiBDaGFuZ2UgbmFtZXMuCkNvdWxkIG1lbHQgTkFORCBjaGlwcyB3aXRoIHB5cm90ZWNobmljcy4gRGFya25ldCBEaWFyaWVzIEUgMzkgaXMgYWJvdXQgdGhhdA==

    • @axelaxel3156
      @axelaxel3156 Před 2 lety

      @@thekeyboard11 huh?

    • @maximilian200057
      @maximilian200057 Před 2 lety

      Who is that girl in your pfp?

  • @Gabriel-_-245
    @Gabriel-_-245 Před 2 lety +127

    Is it only me who watches this content without any intention whatsoever to do anything remotely illegal now or in the future?

    • @holthuizenoemoet591
      @holthuizenoemoet591 Před rokem +29

      nope, its just facinating. I think its a bit like the seccond amendment for americans (im from the EU) where they feel that guns help protect them from the goverment

    • @nunyabiznes33
      @nunyabiznes33 Před rokem +9

      I know 0 shit about tech but I still watch his vids every now and then.

    • @carl6825
      @carl6825 Před rokem +8

      You're not alone, to me it's kind of like watching a true crime documentary, tinfoil stuff is always funny too like "wrap your package in tinfoil broOo0!!1!"

    • @ekremaslan8068
      @ekremaslan8068 Před rokem +11

      of course, sir, I'm also a law abiding citizen just like you, I'd never do anything of the sort.

    • @dinky82920
      @dinky82920 Před rokem +3

      @@ekremaslan8068 Me too!

  • @Mildewpants
    @Mildewpants Před 2 lety +7

    Not even watched this yet, but know it will be very useful, and looking forward to watching it ASAP!
    I tend to blather on a bit when explaining OPSEC and other important internet security measures...but if I send a link to your vids in a groupchat at least one person will watch it which gets the ball rolling.
    Nobody tends to belive me that just paying for a VPN is not really a solution to anything lol.

  • @ivanivanovich231
    @ivanivanovich231 Před 2 lety +109

    "at this point we've entered tinfoil territory" bruh as if everything before that wasn't?

    • @lightyagami1752
      @lightyagami1752 Před 2 lety +53

      From that point on it was *literal* tinfoil territory.

    • @bruh-db8by
      @bruh-db8by Před 2 lety +1

      it isnt tho bro

    • @alreaud
      @alreaud Před rokem +6

      @@lightyagami1752
      Maxwell's 2nd law. Go buy an AirTag and try it out. I used to run a lab at a company that made data conversion products. We had a real Faraday cage, big. We didn't use tin foil, we used a copper mesh. Two layers, separated by a 2x4 and grounded to earth ground. The test was tune the strongest local FM radio station and shut the door. Static...

    • @laststand6420
      @laststand6420 Před rokem

      @@alreaud Would that still work without grounding?

  • @4erepX
    @4erepX Před 2 lety +48

    Good guide, but the thing is , you can achieve decent security from any device if you just SSH to a dedicated server (rented using monero or any other anonymous method) and by using some tor/proxychains . You can change this servers like once in a week or month (depending on your business). And to avoid being compromised u can just setup your own VPN server that will act like a bridge between your PC and Wi-Fi router. So your PC won’t connect to the Wi-fi manually, traffic will always go through some Raspberry PI with VPN on it. Plus you can just carry it around with you and use it with Public Wi-fi which will make really hard for anyone to identify your activity.

  • @Laurens115
    @Laurens115 Před 2 lety +63

    Why is your content always SO good and SO consistent??

    • @KrisAkaVenno
      @KrisAkaVenno Před 2 lety +18

      Shrigma grindset ofc

    • @animepussy8356
      @animepussy8356 Před 2 lety +1

      Meow

    • @rbda8921
      @rbda8921 Před 2 lety +14

      @@KrisAkaVenno Shredded sys admin that uses gentoo in personal laptop, literal gigachad sigma based. My guy IS the steryotype

    • @spamlogs2701
      @spamlogs2701 Před 2 lety +3

      Unlike network chuck he isnt a sensationalist i like it

    • @animepussy8356
      @animepussy8356 Před 2 lety

      @@spamlogs2701 Cat Man vs Network Chud

  • @gregbagel791
    @gregbagel791 Před 2 lety +7

    As a brand new cyber security masters student, I will watch this channel’s career with great interest

  • @beagleonvodka
    @beagleonvodka Před rokem

    Mental Outlaw You're one of my favorite cyber sec channels, each time you upload a video I am compelled to watch.
    Keep it up 💯!!!

  • @uwu
    @uwu Před 2 lety +1

    thank you for everything you do

  • @lavavex
    @lavavex Před 2 lety +14

    I love watching these videos that put me on the fbi watch list, lol. But great vid man, I love cyber security and opsec stuff!

  • @ericm8502
    @ericm8502 Před 2 lety +12

    Great video as always! Teaching valuable cyber security knowledge to this generation of zoomers!

  • @trapOrdoom
    @trapOrdoom Před 2 lety +2

    One of the smartest and most informed, arguably most important CZcams channel.

  • @GaryCameron780
    @GaryCameron780 Před 2 lety +30

    Should law enforcement start asking questions your best option is, "I'm not going to answer that" or "I wish to remain silent." If you're in a jurisdiction where the 5th Amendment or equivalent exists I suggest using it.

    • @tygecafe9070
      @tygecafe9070 Před rokem

      kinda makes you suspicous, i suggest do both lying and remaining silent.

    • @njpme
      @njpme Před rokem +17

      @@tygecafe9070 innocent until proven guilty.

    • @d3stinYwOw
      @d3stinYwOw Před rokem +4

      @@njpme Not in this world dude ;)

    • @KManAbout
      @KManAbout Před rokem +5

      You shouldn't lie because that's a crime. Don't lie and there's nothing they can do. Being suspicious ain't a crime. There's too many suspicious people out there

    • @cipsone3595
      @cipsone3595 Před rokem

      @@KManAboutThat's true! Being suspicious only leads to assumptions not hard proven evidence. So don't lie (if you don't want extra in court) and don't talk to pigs

  • @tommyshaw2420
    @tommyshaw2420 Před rokem +6

    Rule 11. - "Dont tell anyone about your darknet activity".............This is a must, I had a DEA agent tell me one time that if you sell or deal in drugs, every single person who you tell what you are up to( like a friend etc) you are 20% more likely to get caught, therefore if you told 5 people you are 100% guaranteed to get caught.

    • @SouthPeter98
      @SouthPeter98 Před 9 měsíci +3

      5 sequential increments of 20% is 67%, but good adage

    • @michaelangelo0305
      @michaelangelo0305 Před 8 měsíci

      @@SouthPeter98 hows that

    • @stigcc
      @stigcc Před 3 měsíci

      @@michaelangelo0305The probability that none of the five rats you out is 0.8^5=0.33. The probability that at least one of them do is 1-0.33=0.67

    • @michaelstark9988
      @michaelstark9988 Před 9 dny

      @@michaelangelo0305 idk how they got 67% but the probably after telling 5 people in that circumstance would entirely depend on how likely it was to happen before the first person you told. In truth, following the DEA officers logic, then after telling 5 people it would be 2.48832 times more likely than it was before you told anyone at all.

  • @diogosequeira5926
    @diogosequeira5926 Před 2 lety +19

    Even as a law student I absolutely love your videos, don’t ever stop making those

  • @1xadavid
    @1xadavid Před 2 lety +2

    Mental, you are the only channel I turn on notifications for on CZcams. Your videos are that dope. Thank you, and please keep them coming.

  • @axebeard6085
    @axebeard6085 Před 2 lety +43

    I have no idea if it is possible, but it seems to me it would be a fun FU to set up a biometric lock that wipes the machine instead of unlocking it.

    • @cleitonfelipe2092
      @cleitonfelipe2092 Před 2 lety +1

      That's a good idea if you can implement.

    • @axebeard6085
      @axebeard6085 Před 2 lety +5

      @Boy George if you're going to the trouble of setting up a finger-scanner wipe, then chances are opsec is more important to you than accidental data loss.
      And you could probably mitigate that problem by making a bi- or tri-fold wallet/checkbook case so that you don't accidentally touch that scanner while handling the phone. Or some kind of metal slipcase.

    • @cleitonfelipe2092
      @cleitonfelipe2092 Před 2 lety +2

      @Boy George Just don't accidentally scan your thumb

  • @Tallero
    @Tallero Před rokem +4

    even small museums are being offered tools for ai powered visitor tracking from the camera feed. So public route could really be less secure than one thinks. Fascinating stuff.

  • @Griimnak
    @Griimnak Před 2 lety +19

    Having a separate laptop is good because it isolates your main hardware fingerprint from your deepweb hardware fingerprint.
    Example, if you're on windows cmd: wmic baseboard get product,Manufacturer
    This fingerprint of your board is traceable cross OS.
    If you only use one device and it is confiscated on basis of suspicion, they can confirm you are the person of interest via hardware fingerprint. Changing mac and etc wouldn't matter.

    • @Shuroii
      @Shuroii Před 2 lety +10

      KVM doesn't set those by default and it becomes "generic vendor" across the board

  • @24hourtourist
    @24hourtourist Před 2 lety +2

    Wow I'm surprised the YT gods have not pulled this yet as you're posting Darknet bulletin boards, Mental. Good info as always!

  • @dickbrocke
    @dickbrocke Před 11 měsíci +12

    Any joking aside though, the person who authored this excerpt from the OPSEC Bible (being a passage from the Book of Online Ordering) really did put a lot of effort into it.
    Without going into too much detail, I hear from a reliable source that he completed it just before he finally caved (as most vigilant and watchful precaution takers in his position probably would).
    They say that he is now in a much calmer environment, and that the head monk at the monastery only allows the brethren to utter ten words a year, as a Christmas treat.

  • @misty2k645
    @misty2k645 Před 2 lety +5

    im not in this field at all, im an accountant lmao, but i love just listening to you speak all these words hahah keep up the greats vids man

  • @Tarik360
    @Tarik360 Před 2 lety

    Thanks for the upload! Very cool!

  • @jer1776
    @jer1776 Před rokem +2

    Doubt I'll ever have a use for half this info but love to learn about it. Great video

  • @flyback_driver
    @flyback_driver Před rokem +3

    When I was in the military I had a friend of friend in psyops and they frequently handle material that cannot be lost. He taught me in a pinch you can take a handful of misc papers as well as the one you do not want seen and throw them in the kitchen sink. If you have alcohol or acetone dump it on top to bleed the ink and then run water on it. This is obviously a last ditch effort method but I feel like it applies here. Also, for secret documents and above shredding is not allowed. We exclusively burn documents like that because the army does not consider a shredded document destroyed.

  • @foxtailedcritter
    @foxtailedcritter Před 2 lety +53

    I

    • @truerandomchannel
      @truerandomchannel Před 2 lety +5

      he is on odysee

    • @amogus7
      @amogus7 Před rokem +6

      odysee

    • @jtreg
      @jtreg Před rokem +1

      use a spelling checker

    • @beagleonvodka
      @beagleonvodka Před rokem

      Am getting really tired of YT censorship, it's like Googles little bitch caught up in a polygamous love triangle with Zucks metaverse.

    • @dogfacezombie
      @dogfacezombie Před rokem

      Fr

  • @JocularJack
    @JocularJack Před rokem +2

    I feel like I am on a list just for watching this, but I follow Barely Sociable and find his series on DNM's fascinating, so when I saw this video I couldn't resist clicking 😅

  • @YitzharVered
    @YitzharVered Před rokem +6

    I'm currently being sucked into the world of computers and programming all at once it it's quite jarring. I'm trying to learn everything from computer and cpu architecture, selenium web scraping, computer science basics as well as all this tor stuff. This is probably not the best approach I know, but there's so much to learn!

  • @dht7377
    @dht7377 Před 2 lety +28

    Love these type of videos. Huge inspiration for doing drugs and creditcard scams

    • @yourmomgay874
      @yourmomgay874 Před 2 lety +2

      His videos inspire me to go boating.

    • @truerandomchannel
      @truerandomchannel Před 2 lety +1

      @@yourmomgay874 don't forget your thumb-drive with your crypto wallet on it!

  • @privateassman8839
    @privateassman8839 Před rokem +11

    On the topic of privacy screens, there's a way to modify a polarizing filter (by phisically damaging the screen), then attaching a similar filter to a pair of glasses. Basically, only someone wearing the glasses can see what's on the screen. To everyone else, it appears white.

    • @Seeks__
      @Seeks__ Před rokem

      "phisically"

    • @johnnylove2073
      @johnnylove2073 Před rokem +3

      ​@@Seeks__ his name is "Private Assman"

    • @Seeks__
      @Seeks__ Před rokem

      @@johnnylove2073 And you're Captain Obvious.

    • @johnnylove2073
      @johnnylove2073 Před rokem +1

      @@Seeks__ put a loaded Glock in your mouth and do the Lord's work

    • @sebastiangarcia-yb5ro
      @sebastiangarcia-yb5ro Před 10 měsíci +4

      things like that attract attention from a passerby, private yes, eye opening or head scratching yes as well

  • @AriannaEuryaleMusic
    @AriannaEuryaleMusic Před 2 lety +1

    Awesome. I love all this OPSEC stuff

  • @rpm10k.
    @rpm10k. Před 2 lety +1

    Love your videos outlaw!

  • @dumkastriker
    @dumkastriker Před 2 lety +7

    okay my dude, your thumbnail game is lvling up with all them waifus, I can't stop CLICKING

  • @nexusyang4832
    @nexusyang4832 Před 2 lety +17

    You can also password bind the hard drive or ssd through the bios. Once that is done, you can encrypt the drive with hardware/software encryption. To get even nuttier, you can keep a separate encrypted volume that is stored within said volume. I think truecrypt (not sure if that is still around) but they used to offer a false encrypted volume that “looks” real but there is a hidden encrypted partition within it. Kinda trippy.

    • @uniquegod1997
      @uniquegod1997 Před rokem +1

      veracrypt, best encryption Software out there, yep

  • @ruperterskin2117
    @ruperterskin2117 Před rokem

    Right on. Thanks for sharing.

  • @mikhailsharon4331
    @mikhailsharon4331 Před 2 lety

    This man is making the world a more secure place.

  • @mr.cauliflower3536
    @mr.cauliflower3536 Před 2 lety +6

    I think the amount of people stealing pendrives with bitcoin wallets will increase as time goes on.

  • @MirajMusicUSA
    @MirajMusicUSA Před 2 lety +10

    No joke. You have the best channel on CZcams.

  • @crackheadgamer9880
    @crackheadgamer9880 Před 2 lety

    love your videos keep up the quality content

  • @Sammysosa3
    @Sammysosa3 Před 2 lety

    Great Video. I had never thought of the possibility of using an antenna to connect to public Wi-Fi from range. That is very cool!

    • @stigcc
      @stigcc Před 3 měsíci

      If they know you are connecting to a public wifi, they will find you, I guess. But, if you use Tails, then they would never see your IP?

  • @user-vn9ld2ce1s
    @user-vn9ld2ce1s Před 2 lety +16

    I have no idea why i'm watching this. No plans to do any illegal activity, unless our state falls into totality (again lol). It's just interesting, i guess

  • @rileybrown9045
    @rileybrown9045 Před 2 lety +51

    To add onto the darknet laptop angle: If you wear glasses, get a polarized pair & remove the polarizing film on the display of the laptop

    •  Před 2 lety +41

      If anyone sees you looking at a white screen for hours, they will think you are crazy

    • @tolkienfan1972
      @tolkienfan1972 Před 2 lety +1

      Genius!

    • @hasher9360
      @hasher9360 Před 2 lety +13

      @ or they could see the actual reflection of CP and _know_ you are crazy

    • @joey199412
      @joey199412 Před 2 lety +1

      Any tutorial for how to do this?

    • @osurgac
      @osurgac Před 2 lety +8

      Old thinkpads have a privacy filter on them by default. They call it a TN panel

  • @funnifurrytechgirl
    @funnifurrytechgirl Před rokem +2

    This guy is the reason I installed Gentoo, and I'm currently loving it.

  • @dannys9074
    @dannys9074 Před 2 lety

    Great content brother. Thanks

  • @poprawa
    @poprawa Před 2 lety +3

    Separating hardware is proper way to go as if main and darknet machines are on in the same time there is no way to proof remotely by correlation, that one fingerprint is always off when second one is on. When working on years of aggregated data this method can really precisely point who owns what

    • @poprawa
      @poprawa Před 2 lety

      live cd first off when second on, and vM first on when second on and second disconnects before first does.
      It is not about who to hack, but who to raid

  • @roboticbrain2027
    @roboticbrain2027 Před 2 lety +8

    The reasoning behind a separate laptop comes from a real concern about firmware level viruses. At least theoretically it is possible to persistently compromise a device in a way which is undetectable by the running OS. There have been numerous research papers about it. However if that happens, I'm not sure if Tor etc. would do you any good anyways.

  • @naesone2653
    @naesone2653 Před 2 lety +1

    Love the videos keep it up

  • @Tobi_Jones
    @Tobi_Jones Před 2 lety +1

    great video, learned a lot, thanks

  • @rldp
    @rldp Před 2 lety +91

    Whonix is theoretically more secure than Tails. Because Whonix uses a separate virtual machine for routing all traffic to tor (gateway) even if you fuck up and infect your workstation VM, it is near impossible to get your real ip without also infecting gateway vm. Also it has more built-in anonymization tools and techniques.

    • @alexdelarge9425
      @alexdelarge9425 Před 2 lety +4

      The only advantage Whonix has over Tails is malware protection.

    • @kim-hendrikmerk4163
      @kim-hendrikmerk4163 Před 2 lety +26

      To attack a Tails machine you would need either root access to Tails it slef or BIOS acess to the host computer. There is no way to access the internet on tails without tor.

    • @serpentixx854
      @serpentixx854 Před 2 lety +5

      Yes, but if i.e. the screen or keyboard of your host are compromised, then whonix would be indirectly compromised too. Best would be to have a Live USB with Whonix on top in VMs on a persistent storage and do not use the host at all, except for installing the hypervisor and updating the system. That way you reduce the attack surface of the host, but get the advantages of Whonix.

    • @ButWhyMe...
      @ButWhyMe... Před 2 lety +2

      What about Qubes?

    • @ButWhyMe...
      @ButWhyMe... Před 2 lety +1

      @@leeroyjenkins0 Yea, I think so too. I just hate that Qubes "requires tons of ram". I really want to try to run it with only 4 gbs of ram to test that theory.

  • @seekingagreatperhaps6391
    @seekingagreatperhaps6391 Před 2 lety +6

    If I was in charge of interdiction efforts, I would put a lot of resources into the weakest leg of the darknet supply chain, the postal system. I'd be using AI to spot patterns, and I'd do a heck of a lot of random, passive scans of packages using machine learning to determine what is normal and what is not - weight/size of package, odor detectors, x-ray, and so on. And I mention this just to underscore that for all of this digital opsec, once a package is in the mail with your name on it, that's probably the biggest risk, and it is also the thing you control the least.
    I wouldn't bet on whether Darknet markets as a main source of non-government-approved goods will become more or less viable in the future, because they will keep building up government infrastructure around the postal service and they will strong-arm the big shipping companies the way they did a certain telecom some years ago with that room in San Francisco: they will make these companies an offer they can't refuse.

    • @Jacob-ol9ji
      @Jacob-ol9ji Před rokem

      Ordering safely online will always be better then meeting someone on the street.

  • @cdgonepotatoes4219
    @cdgonepotatoes4219 Před 8 měsíci

    I'm never gonna need all this, but always good to know

  • @ergosum5260
    @ergosum5260 Před rokem

    My dig sometimes keepees on my rugs.
    Very informative.

  • @Lemonz1989
    @Lemonz1989 Před rokem +8

    Great video ☺️
    I’m not a vendor, by the way, I just worked at a package sorting center for my national postal company. I just want to point out one thing people might not be aware of.
    I don’t know if it’s similar in other countries, but I wouldn’t have a return address at all on the packages if I was a vendor. I’d rather the package go to waste than it leading back to me, because you are guilty of possession and possibly distribution if you are sending or have been sent mail with illegal *rugs in my country; even if the mail was intercepted before arrival.
    Many countries don’t accept international letters or packages with stamps on them anymore, and will reject them, and possibly open them. They might send them back to you if you have a return address, or destroy them if you don’t have a return address. In the latter case, they will probably open it first, to see if there is any identifying information on the sender inside the letter/package.
    If you want to send past international borders, you will need a postal code or a letter/package label and possibly a special label made for customs authorities in the receiving country before countries accept the mail. These codes are unique for each letter/package. Most of these labels are bought online in my country, and you will receive a receipt to your chosen email, and will have to pay with a card. These labels require a return address before allowing you to buy them. Even if they don’t require a return address, I’m pretty sure the police are able to connect the payment card with the unique letter/package label, if they are really insistent on finding the sender.
    However, if you are able to send internationally with stamps, like within the European Union, which has free movement of goods between member countries, then do that.
    Remember not to lick the stamps (because of DNA), and it would be advisable to only handle the letters/boxes with gloves on, because many countries have national databases of fingerprints now due to the new biometric passports (the majority of Europeans have passports).
    This might seem insane and tinfoil hat worthy, but these are things that CAN happen, but probably won’t if you are a small vendor. It’s worth going a bit overboard, in my opinion, when you have taken all these steps to stop tracking online, and then risk being caught because of a relatively low tech mistake when mailing things.

    • @maricelaguzman2965
      @maricelaguzman2965 Před rokem

      They use return addresses of businesses that they are not associated with.

    • @Lemonz1989
      @Lemonz1989 Před rokem

      @@maricelaguzman2965 Do they use just any random business as a return address?
      That would, however, still leave the problem with payment cards possibly being associated with postal labels.

    • @maricelaguzman2965
      @maricelaguzman2965 Před rokem

      @@Lemonz1989 NO LOL. Bro.... The vendors do not pay postage with their card that's in THEIR name that would be idiotic. They use crypto postage services and most likely theyt have runners that drop their packages.

    • @Lemonz1989
      @Lemonz1989 Před rokem +1

      @@maricelaguzman2965 Where on earth would you pay for postage with crypto? El Salvador?? It’s literally impossible in Europe, as far as I know. And it’s extremely difficult, if not illegal, to get an anonymous payment card in Europe, due to money laundering laws. And crypto isn’t anonymous either. Only Monero, of the major currencies, is completely anonymous.

    • @stigcc
      @stigcc Před 3 měsíci

      Not sure why using regular stamps is a bad idea. If you don't leave fingerprints or DNA on them, they are not possible to track back to you.

  • @garchamp9844
    @garchamp9844 Před 2 lety +5

    Is booting Tails from your normal everyday driver laptop safe? In terms of darknet opsec of course. Can the glow-in-the-dark Windows installation on the laptops internal drive see what you are doing in any way?

  • @user-jx2kg2er5o
    @user-jx2kg2er5o Před 11 měsíci +1

    Dude fucked up when he said "tell the feds XYZ". Plead the 5th, PERIOD. By the time they have you in a room that's your best option.

  • @gitgudchannel
    @gitgudchannel Před 2 lety +6

    why do you even need to lurk on the darknet that much, stop glowing Kenny

  • @corejake
    @corejake Před 2 lety +7

    This bible is kinda glowing ngl.

  • @TheGoodChap
    @TheGoodChap Před rokem +3

    Idk if you've seen domas's lectures on hardware CPU backdoors and undocumented instructions but I think it's extremely interesting and am not even sure just how much it could affect but its sort of a big deal

  • @michealpearson8448
    @michealpearson8448 Před 8 měsíci +1

    Cheers bro I bought some crack using these methods the other day x

  • @tuskiomisham
    @tuskiomisham Před 2 lety +41

    There are 2 types of drug purchasers.
    This guy, the schizo dark net enthusiast.
    Me, the Facebook marketplace enjoyer.

  • @seronymus
    @seronymus Před 2 lety +9

    Christ-chan thumbnail in 2022? Based bless you MO

  • @randommarkonfilms3979
    @randommarkonfilms3979 Před 2 lety +7

    Actually too you wanna unplug power from the computer after using TAILS. Technically keys may still be extractable for a bit. Also any computer with Intel ME or AMD PSP are other attack surfaces to be aware of.

  • @paultidwell8799
    @paultidwell8799 Před rokem +1

    Necrobump. Never stop making videos kenny.

  • @wilurbean
    @wilurbean Před 10 měsíci +2

    Everything he said about the packages is true. It's been done.
    To prosecute they need intention and possession

  • @jairomanzano894
    @jairomanzano894 Před 2 lety

    great info i love info! subbed

  • @v3listube
    @v3listube Před 2 lety +3

    It's been about 8 years since I looked into opsec and the same practices ar still relevant.

  • @tjmbv8680
    @tjmbv8680 Před 2 lety +3

    I wouldn't update daily but weekly unless its a critical security patch, the reason being to give updates some time to make sure they are fully secure and don't have an obvious security venerability

  • @rotteegher39
    @rotteegher39 Před rokem +2

    6:47 about the screen polarizer. If you are technical and have some tools and know what you are doing you can peel of the polarized layer of the screen so it would show only as white screen backlight. You can buy or make specialized glasses from this peeled polarizer to polarize the light that is coming from the white monitor to see what's actually it's displaying.
    Others with naked eye would only see you staring at the white screen with some glasses on that would let you see the contents on the monitor.

    • @SouthPeter98
      @SouthPeter98 Před 9 měsíci +3

      That's super silly, immediate give-away that you're up to no good to anyone that sees the screen. Anyone can search what that is only and put the polarizing film over a normal camera and point it at you. There are only downsides with this, on top of it making you look like a creep

  • @imagreatguy1250
    @imagreatguy1250 Před rokem

    Bro, i really love your stuff, I'm a closet Linux noob, lol, but really these videos are my reason for CZcams 🙏

  • @chubbycatfish4573
    @chubbycatfish4573 Před 2 lety +3

    We should all live like Brill from Enemy of the State.

  • @turtleb01
    @turtleb01 Před 2 lety +3

    With tails on an old thinkpad, your wipe key is pulling out the battery.

  • @sciencecat5140
    @sciencecat5140 Před 2 lety +2

    You change my life. Now gov stalk me physically...

  • @theITGuy-no3nt
    @theITGuy-no3nt Před 2 lety +6

    I think TAILS is the best solution for the vast majority of use cases. No new hardware to buy, it generally warns you if you attempt to do anything stupid, has TOR baked right in, will let you you set up a bridge, never writes to local storage, yadda, yadda, yadda. It just wins. 🥇

  • @deathtoyoutubeandtwitterbu5865

    Hot key is good. What's even more useful (esp in tandem with a hotkey) is whitelisted usb devices.
    Any USB device you haven't specifically whitelisted gets plugged into you computers and it causes an immediate and instant power off. The feds ain't gonna extract much if they can't plug in their storage devices

    • @BrandonCurington1
      @BrandonCurington1 Před rokem

      power off or kill switch (unless you enter a specific line beforehand?)

  • @angelrosas3724
    @angelrosas3724 Před 2 lety +8

    Rule 1:
    Everything is a larp except that which is hiding as a larp.

  • @rogersherman9360
    @rogersherman9360 Před 2 lety

    thank you brother

  • @davidstocker2278
    @davidstocker2278 Před 9 měsíci

    A good bit of advice I heard from SIM. No one in jail was too paranoid