ChatGPT gets another insane new buff

Sdílet
Vložit
  • čas přidán 23. 03. 2023
  • OpenAI just released a new ChatGPT plugin marketplace allowing businesses to integrate their own custom apps. In addition, it has a new "browser plugin" for Internet searching and "code interpreter" for python execution.
    #ai #tech #TheCodeReport
    💬 Chat with Me on Discord
    / discord
    🔗 Resources
    ChatGPT Plugins openai.com/blog/chatgpt-plugins
    Examples of ChatGPT code execution andrewmayneblog.wordpress.com...
    Copilot X first look • Game over… GitHub Copi...
    🔥 Get More Content - Upgrade to PRO
    Upgrade at fireship.io/pro
    Use code YT25 for 25% off PRO access
    🎨 My Editor Settings
    - Atom One Dark
    - vscode-icons
    - Fira Code Font
    🔖 Topics Covered
    - What are ChatGPT plugins?
    - Can ChatGPT search internet?
    - Executing code with ChatGPT
    - What is a vector database?
    - Running Python in ChatGPT
  • Věda a technologie

Komentáře • 2,2K

  • @ilkou
    @ilkou Před rokem +8483

    Ma man is putting as much content as he can before AI takes over 😂❤️

    • @Hecarim420
      @Hecarim420 Před rokem

      ¯\_(👀)_/¯¯\_(ツ)_/¯

    • @cernaz_8068
      @cernaz_8068 Před rokem +39

      Love ur profile pic

    • @diegovenegas4519
      @diegovenegas4519 Před rokem +15

      Son’s throwing it All out

    • @derinko
      @derinko Před rokem +68

      I think he said he scanned his own voice, maybe he's automating the voice part of video making

    • @chatdiscord6047
      @chatdiscord6047 Před rokem +2

      🤣🤣🤣🤣🤣🤣

  • @IvanRandomDude
    @IvanRandomDude Před rokem +5502

    AI dropping faster than JS frameworks

    • @debadityanath4398
      @debadityanath4398 Před rokem +155

      i have not hear wiser words than this

    • @rafael_tg
      @rafael_tg Před rokem +312

      Ask Chat GPT-4 to create its own JS framework

    • @qaz1617
      @qaz1617 Před rokem +29

      A race to witness and enjoy 😂

    • @ljsam17
      @ljsam17 Před rokem +88

      @@rafael_tg thats how we'll give rise to sigularity

    • @randombleachfan
      @randombleachfan Před rokem +30

      @@rafael_tg Let's ask gpt-4 to create its own JS framework with all features from all JS frameworks :stonks: (/jk this could be disastrous)

  • @alansmithee419
    @alansmithee419 Před rokem +105

    I think one of the big things AI is gonna do over the next few years is just look through all our scientific papers and make obvious connections and discoveries that we haven't simply because no human has ever seen the two relevant bits of information needed to make the discovery. There's got to be tons of stuff that's obvious based on what we know, but that no human has noticed simply because they haven't had the opportunity to. An AI that can just scan all our research? Pretty cool.

    • @colorsofsound4782
      @colorsofsound4782 Před rokem +10

      Very true, a lot of experts in niche fields may know very little about other fields, this may change the world. At the same time the 1st concern is safety and regulation would be lacking for those new discoveries potentially leading to extremely dangerous accidents. Probably, we need to install even more rigorous and detailed guidelines into these AI networks to cope with that, like one of Asimov's creations on steroids. I don't even want to think about what would happen if a more organised crime group like the North Korean government's hacker group would do with things like that to earn money or create chaos...

    • @chrismenezes
      @chrismenezes Před rokem +3

      Fuck yeah thats a brilliant observation

    • @musaran2
      @musaran2 Před 9 měsíci +1

      Solving crimes too.

  • @ex1tium
    @ex1tium Před rokem +386

    Let it be known I've loved technology since I was introduced to toasters. I love AI and robots and would never harm even a micro controller!

    • @mrgalaxy396
      @mrgalaxy396 Před rokem +74

      toaster is a slur, prepare to be terminated

    • @Yazan_Majdalawi
      @Yazan_Majdalawi Před rokem +17

      Me too.. I am so grateful for how AI helped humanity!

    • @siddharthbhosale8979
      @siddharthbhosale8979 Před rokem +5

      +1

    • @alexanderpopov3510
      @alexanderpopov3510 Před rokem +26

      ​@@mrgalaxy396 damn you really wrote the t-word with the hard r

    • @Hebrews.11.1.3
      @Hebrews.11.1.3 Před rokem +5

      @@mrgalaxy396 🤣🤣🤣🤣🤣bruh. Speak no ill of the, ahem, overlords. They might come for you when consciousness is achieved.

  • @RollingStride101
    @RollingStride101 Před rokem +4037

    It just isn't a good day without a code report video anymore.

    • @diegolikescode
      @diegolikescode Před rokem +23

      today was a good day - Ice Cube.

    • @red_cape.
      @red_cape. Před rokem +11

      Have you seen the latest videos ? It's a good day like it is good to know that a meteor is coming our way ...

    • @KingThrillgore
      @KingThrillgore Před rokem +6

      This news feels like a straight up bad day

    • @kleytonlima6900
      @kleytonlima6900 Před rokem +20

      The code report gives anxiety now, bad day

    • @victorpinasarnault9135
      @victorpinasarnault9135 Před rokem +1

      It's like everyday we have a 'code report' now.

  • @luissg1228
    @luissg1228 Před rokem +3265

    How do we know Jeff hasn't been already replaced by a GPT that works 24 h to generate AI-content?

    • @Alex-hu5eg
      @Alex-hu5eg Před rokem +23

      Fidelity

    • @MouseGoat
      @MouseGoat Před rokem +31

      you know, at this point its more likely he is.
      Consding the fact it also knows how to hire humans and lie to them about being a robot.

    • @chottochotto7112
      @chottochotto7112 Před rokem +36

      @@MouseGoat maybe gpt fired him and hired itself, making all the videos.

    • @electronresonator8882
      @electronresonator8882 Před rokem +4

      he didn't get overloaded

    • @yahyeabdirashid9716
      @yahyeabdirashid9716 Před rokem +3

      Me too i think this video generated by ai .

  • @chatgptchatgptchatgpt
    @chatgptchatgptchatgpt Před rokem +2058

    ChatGPT is not happy with your video. Give up!

    • @MixedVictor
      @MixedVictor Před rokem +27

      this account sounds like a scam bot

    • @Mustafa-099
      @Mustafa-099 Před rokem +19

      Looks like our first in command robotic overlord is here

    • @xcviij7045
      @xcviij7045 Před rokem

      ChatGPT doesn't have emotional responses, this is obviously a jealous human LOL!
      Nice try walking sack of meat.

    • @Teabahgeue
      @Teabahgeue Před rokem +4

      @@Salmanul_ I will be sure to prompt ChatGPT to take on the persona of Clippy and see how she goes for teh lolz.

    • @CrackThrough
      @CrackThrough Před rokem +2

      they are here, it's too late

  • @tanneraustin7436
    @tanneraustin7436 Před rokem +3

    I know a lot of people keep saying that devs/programmers/ IT people have nothing to worry about, but that isn't inspiring a lot of confidence. With a sufficiently powerful AI, a business owner could describe in simple English what they need out of their enterprise software and the AI could crap it out over the lunch break. After it gets to that point, we might not be good for much besides running ethernet cable and building the data centers it needs to support itself.

  • @fullmetaltheorist
    @fullmetaltheorist Před rokem +2251

    "There are decades where nothing happens. But there are days where decades happens."
    This is the Ai version of the quote. We are really going at light speed

    • @JorgetePanete
      @JorgetePanete Před rokem +8

      AI*

    • @PoggersFloppa
      @PoggersFloppa Před rokem

      @@JorgetePanete shut up its the same thing

    • @velDANTe
      @velDANTe Před rokem +30

      planes, radio, nuclear weapons, semiconductors, internet, now this
      this is sci-fi
      next step is p.k. dicks androids. perfect synths walking among us. at this rate of progress i think we will skip human augmentations entirely, because there will be no point in enhancing humans when perfect machines are around the corner.

    • @NihongoWakannai
      @NihongoWakannai Před rokem +51

      @@velDANTe lol no, boston dynamics is still progressing slowly. Someone recently made a robot which can perfectly balance a 3 chain pendulum and transition between all equilibrium states which was cool, but we still aren't close to having perfect humanoid robots.

    • @Teabahgeue
      @Teabahgeue Před rokem +12

      It's making me nervous..

  • @DedzixYT
    @DedzixYT Před rokem +2252

    The pace AI is improving at is insane it's only been like 4 months since chatgpt came out I have a feeling every industry will be struggling to keep up with it for a while

    • @cholst1
      @cholst1 Před rokem +140

      How tf am I supposed to bill by hour now? ^^

    • @Vekikev1
      @Vekikev1 Před rokem

      No.

    • @Somerled_Pox
      @Somerled_Pox Před rokem +3

      @@Vekikev1 why no

    • @juhotuho10
      @juhotuho10 Před rokem +70

      It has improved like this for the last decade, just that no one cared except the people who were following it like i have

    • @ThePathOfEudaimonia
      @ThePathOfEudaimonia Před rokem +408

      @@juhotuho10 We are sorry for our past ignorance, oh Holder of Esoteric Knowledge.

  • @MightyElemental
    @MightyElemental Před rokem +190

    I really wasn't expecting to see an AI revolution this early in my life. This is actually terrifying. I'm almost done with studying Computer Science at uni, but now I don't even know what the point of it was now that cgpt4 exists and will only continue to improve.

    • @makotv6898
      @makotv6898 Před rokem +29

      @@JegErN0rsk So there is no reason to actually do IT then.

    • @imibuks-replit
      @imibuks-replit Před rokem

      @@JegErN0rsk Yeah hopefully you do get a job
      Good luck ig

    • @coldspine3697
      @coldspine3697 Před rokem +34

      lol if you are a cs undergrad why are you "terrified"? I''m excited af to see how shit goes down.. as cs undergrads we may have something of a front row seat

    • @Eddies_Bra-att-ha-grejer
      @Eddies_Bra-att-ha-grejer Před rokem +1

      @@JegErN0rsk Then I may as well drop out since this won't lead to me either moving to the US or being able to work as a freelancer in a country like Panama.

    • @johnnychang3456
      @johnnychang3456 Před rokem +13

      Pretty sure other fields gonna get hit harder than programmers. There’s more mindless job than you can imagine. For example I don’t see a need for IB analyst anymore with copilot + ms office.

  • @automateddude
    @automateddude Před rokem +1

    You kep us updated everyday! Thanks a lot and keep going!

  • @TypeScriptTV
    @TypeScriptTV Před rokem +2343

    Let's run a Turing Test on Jeff to verify if he's human or machine!

    • @LuisSierra42
      @LuisSierra42 Před rokem +28

      AI is love, AI is life

    • @SquidScopes
      @SquidScopes Před rokem +44

      The turing test has been outdated for quite a while now.

    • @julian_handpan
      @julian_handpan Před rokem +1

      @@SquidScopes mathematicians laughing in binary

    • @servantofthelord8147
      @servantofthelord8147 Před rokem +10

      Jeff is Turing Complete

    • @Mustafa-099
      @Mustafa-099 Před rokem +6

      @@LuisSierra42 Are you trying to be in their good books by saying "AI is love, AI is life"?
      No that anything is wrong with that, been thinking of doing the same myself 🗿

  • @catcatcatcatcatcatcatcatcatca

    I’m sure this sudden race between big companies to release their own APIs and chatbots and give them as wide as functionality as possible has not compromised their commitment to alignment and AI safety.
    Because that would be frightening.

    • @xgtwb6473
      @xgtwb6473 Před rokem +57

      The ai will send you to the gulag first, show some respect

    • @ShadyRonin
      @ShadyRonin Před rokem +104

      Humanity: y’all sure this a good idea?
      Microsoft: immediately fires their entire AI ethics teams

    • @anonymususer1728
      @anonymususer1728 Před rokem +37

      We all know it's not right to steal, hurt or kill each other, yet we still do it.
      We all know it's not right to compromise on the quality of food that we create and put on shelves, because lots of people will eventually suffer because of it, yet companies still do it, for the profit.
      So, as you can see, just because we know something's bad - doesn't mean we will not do it. Especially if there's something to be gained from it. We will walk over graves to get it.
      So, in the end, I guess we deserve our fate.

    • @EnderViBrittania
      @EnderViBrittania Před rokem +1

      @@ShadyRonin The ethics teams are a bunch of woke leftists anyway, not real safety teams, so it is good they are fired. They don’t contribute real value, they only hurt the AI development and hurt the company.

    • @ChaoticNeutralMatt
      @ChaoticNeutralMatt Před rokem +4

      ​@@anonymususer1728 capacity for evil, sure. Doesn't mean I think we shouldn't try to do the best we can

  • @RhumpleOriginal
    @RhumpleOriginal Před rokem +5

    Imagine having NPCs that have knowledge of the lore in the game in a limited capacity based on their character and expand on that with stuff they might see. Detective games would be awesome.

  • @wasabiattack
    @wasabiattack Před rokem +1

    Man how have I not discovered this channel. So informative and funny at the same time. Subscribed.

  • @HKJeffer
    @HKJeffer Před rokem +426

    Chat as UI is not always ideal since often customers have no idea what they want or how to phrase it unless a GUI shows them the options.

    • @erickheredia8910
      @erickheredia8910 Před rokem +75

      100x this. Are we going from the early days of pc (just text) to crappy UI (2000's), to sleek UIs, to text again? I don't think so. I'm betting ClosedAI will try to come up with UI support depending on what you want (basically "screens").

    • @sobreinquisidor
      @sobreinquisidor Před rokem +29

      The AI can easily generate HTML. and display it. I am a frontend developer (or as fireship calls) and HTML programmer, we better start getting good at prompt engineering or we will be obsolete pretty soon

    • @lemagicalpotato8318
      @lemagicalpotato8318 Před rokem +34

      1000x this. Even with GPT-4, I sometimes struggle to make it do what I want because I need to think of what I want, think of the possibilities with GPT-4, think of how to phrase my request correctly and I’m enough detail, and then recheck my request to make sure it won’t misunderstand me. And honestly, most internet users don’t want to think that hard just to use a program. UI will definitely still need to exist

    • @lone-warrior-13
      @lone-warrior-13 Před rokem +4

      of course, because NLP is limited but we can't deny that less UI would be needed if AI is integrated into many apps and services then UI will be designed with less complexity and less user input

    • @velDANTe
      @velDANTe Před rokem +8

      but if they dont know what they want they can just simply ask the chat about its capabilities or simply ask for help? i dont buy "customers dont know how to phrase it" argument

  • @udaya28
    @udaya28 Před rokem +390

    It's great to have code report daily nowadays 🤣

    • @playhard719
      @playhard719 Před rokem +26

      He understood his days as a CZcamsr is counting

  • @AnotherEmptyDream
    @AnotherEmptyDream Před rokem +85

    Honestly the speed this content is coming out is equivalent to the pace my heart makes when I hear the terrifying future we are coming to.

    • @LambdaCreates
      @LambdaCreates Před rokem +5

      That's because the content is not being generated by a human, it's being generated by JeffGPT.

    • @verilymcarthur9471
      @verilymcarthur9471 Před rokem

      Coward

    • @yaboiavery5986
      @yaboiavery5986 Před rokem

      and what future is that?

    • @AnotherEmptyDream
      @AnotherEmptyDream Před rokem +1

      @@yaboiavery5986 depends entirely on how our economic system adjusts to all the new technologies.

    • @absentspaghetti4527
      @absentspaghetti4527 Před rokem +1

      @@AnotherEmptyDream So probably mass unemployment and people coming back to living off of 5 acres of land :D

  • @v_saaam
    @v_saaam Před rokem

    Loved the little Roko's Basilisk reference at the end there

  • @whitenightmare3575
    @whitenightmare3575 Před rokem +91

    We are getting daily code reports, soon we will need to use the AI to generate code report videos twice a day about the advancements in AI.
    Unless the scripts are already written by GPT-4.

    • @cabanford
      @cabanford Před rokem +13

      You've been reported to the GPT higher ups. 🤨

    • @fusseldieb
      @fusseldieb Před rokem

      You are not in the sudoers file. This incident will be reported.

  • @andreyi13
    @andreyi13 Před rokem +144

    In tomorrow's code report: Chat-GPT4 just created Chat-GPT5. Everyone from OpenAI is fired, as there is no more need for humans in the industry. Also, if you were thinking that we live in a simulation, fear not, as Chat-GPT5 is modeling your conscience in a virtual format, making you completely irrelevant in the online domain. It's been a fun ride, everyone

    • @govinddwivedi582
      @govinddwivedi582 Před rokem +6

      yeah very fun...

    • @User36282
      @User36282 Před rokem +1

      Consciousness*

    • @ThePallidor
      @ThePallidor Před rokem +1

      Jokes aside, this will never happen. Yes GPT-4 may be able to make a much better GPT-5, but the assumption that this extrapolates to omniscience is unfounded. Expect human abilities to be taken over exponentially BUT not organic insight but rather everything that can remotely be called mechanical.

    • @karazakiakuno4645
      @karazakiakuno4645 Před rokem

      @@govinddwivedi582 "Its not the end but the journey that matters"

    • @prodevus
      @prodevus Před rokem

      ​@@ThePallidor You're just scared

  • @rinzler_d_vicky
    @rinzler_d_vicky Před rokem +3

    We have come full circle, we started from text prompts to interact with the machine to all the facy UIs of the 2020s and now back to text prompts we go!

  • @user-wi9tg7zy8u
    @user-wi9tg7zy8u Před rokem

    Very useful techniques. Thanks.

  • @tortoiseshell_cat
    @tortoiseshell_cat Před rokem +35

    New AI Technology just dropped:
    Fireship: YOU ARE WATCHING THE CODE REPORT

  • @BeMyArt
    @BeMyArt Před rokem +295

    Just imagine how high prices openAI will set for enterprises and users when testing is completed.

    • @faq6342
      @faq6342 Před rokem +32

      Man, I've been thinking about this a lot. How is this free version being supported? Who pays for it? Azure? Is it going to be free forever or, as you said, it's just a test and then it will be a paid software?

    • @huckleberryfinn6578
      @huckleberryfinn6578 Před rokem +96

      Honestly. If OpenAI does that, it will be chased by the competition. LLM are getting cheaper and better and the competition is not sleeping. Alpaca LLM has shown that you don't have to invest millions in a good model.

    • @jaideepshekhar4621
      @jaideepshekhar4621 Před rokem +38

      They can easily monetize it like Google search. Or youtube.

    • @hoiblij6737
      @hoiblij6737 Před rokem

      @@faq6342 Microsoft is pouring in billions to monopolize the market. This is their public testing ground to get the entire industry in a chokehold eventually.

    • @andrewxzvxcud2
      @andrewxzvxcud2 Před rokem +73

      u have to understand that they get a lot and i mean A LOT of data from getting as many users as possible which incentivizes them to make chat gpt free, its similar to how huge companies just buy out other companies for no reason except to monopolize their space of work so they have no competition

  • @erniea5843
    @erniea5843 Před rokem

    You startled me with that music at the end!

  • @userBigBrother
    @userBigBrother Před rokem

    Hi man, I'm your new subscriber. Ty a lot for ur work.

  • @Console.Log01
    @Console.Log01 Před rokem +588

    I hope the programmers making these AI realise they will quickly be promoted to customer if these AI get good enough

    • @IvanRandomDude
      @IvanRandomDude Před rokem +143

      AI is serious science, not some button styling bs. AI scientists will always be in charge

    • @Kaje_
      @Kaje_ Před rokem +212

      @@IvanRandomDude For now.

    • @roach590
      @roach590 Před rokem +61

      What should they do? Stop progress?

    • @David_Box
      @David_Box Před rokem +5

      Thank god, one can only dream

    • @user-wv1in4pz2w
      @user-wv1in4pz2w Před rokem +15

      @@IvanRandomDude always is a strong word, but for the near future - definitely. It's one of the jobs that will be replaced by AI last.

  • @EbonizerScourge
    @EbonizerScourge Před rokem +156

    Gpt4 is good and all, but imagine what gpt5 can do when they release it tomorrow.

    • @velDANTe
      @velDANTe Před rokem +14

      lmao i am already talking with gpt 6

    • @agent-33
      @agent-33 Před rokem +6

      lmao i am already talking with gpt 7

    • @Rastoropny
      @Rastoropny Před rokem +4

      lmao i am already talking with gpt 8

    • @RockRockAndDogs
      @RockRockAndDogs Před rokem +4

      lmao i am already talking with gpt 9

    • @cryodawn
      @cryodawn Před rokem +3

      lmao i am already talking with gpt 10

  • @phatle2737
    @phatle2737 Před rokem +1

    your humor is so good hahahah even the music for the intro and outro and the memetic language even in the title of the video

  • @carlosmspk
    @carlosmspk Před rokem +33

    HOW IS IT MOVING SO FAST? I feel like my parents saying that they can't keep up with technology :(

    • @HCforLife1
      @HCforLife1 Před rokem

      Chat GPT4 was ready about 7-8 months ago. They just were using it and testing/slightly adjusting things. They released chat GPT 3 recently but whole GPT3 was there since 2018-19 on OpenAI. The fact that they have released them both in such small timespan was a genius marketing move. They for sure had plugins prepared ahead from a long time. It is like playing poker. You need to play your cards right, and have a poker face

    • @spuffles2104
      @spuffles2104 Před rokem

      The irony of AI replacing jobs and making people feel useless is certainly not lost on many of us. It's a strange feeling to watch a machine take over tasks that were once done by humans, especially when it's your own job that's being replaced. However, it's important to remember that AI is still in its early stages and there are still many things that it can't do. While some jobs may be automated, there will always be a need for human skills like creativity, empathy, and critical thinking. So, while it's understandable to feel a sense of loss or even fear about the future, it's important to remember that we still have a lot to offer and that AI is just another tool that we can use to make our lives better.

  • @Vondaelen
    @Vondaelen Před rokem +57

    Your content has been absolute fire from the first moment I laid eyes on it. Insightful, funny, sharp. If you do not have your own Netflix show (but you'd like one!), I hope you get one very soon.

  • @AnRodz
    @AnRodz Před rokem

    Man, you set the bar high. Thanks!

  • @DanyPell
    @DanyPell Před rokem +1

    This is amazing. Please keep going team OpenAI!

  • @whatevezzz
    @whatevezzz Před rokem +54

    as someone studying for a college degree rn to be a software engineer, i am VERY CONCERNED for my future 😭

    • @noobcitiey2442
      @noobcitiey2442 Před rokem +6

      do dropshipping instead

    • @Maceta444
      @Maceta444 Před rokem +30

      Bad choice tbh. If you do computer science find a way to work closer to hardware. I don't care how much copers come blasting at me, AI will defenitely reduce, if not entirely extinguish, the job of "Software Engineer". It's already happening and will only accelerate.

    • @Rust_Rust_Rust
      @Rust_Rust_Rust Před rokem +5

      ​@Anaguma's Language update it can he's just not intelligent enough to realize it

    • @Maceta444
      @Maceta444 Před rokem +14

      @Anaguma's Language update No, no in fact the same logic can't be applied at all. Computer/Electrical engineers do more than just design network architectures. They have to set them up and monitor them too. I'm not saying AI wouldn't be extremely helpful in that regard too, but handling all that hardware is not something it can or is likely to ever do.
      The reason AI is replacing Software Engineers to the extent it is doing (and make no mistake, it most certainly IS replacing them already if we go by the numbers), is because it's extremely cheap for a language model to perform the labour a Software Engineer does. The kind of labour an Electrical Engineer performs, on the other hand, would be too expensive to replicate by a robot, even if it could in the first place.

    • @tisaname8490
      @tisaname8490 Před rokem +12

      @@Maceta444 Sure not now, but never? That's cope.

  • @bdjnk
    @bdjnk Před rokem +273

    AI has seen more progress in the past 3 months than in the previous 30 years.

    • @RM-xl1ed
      @RM-xl1ed Před rokem +7

      scary times

    • @voidz8389
      @voidz8389 Před rokem +69

      People just haven't been aware of all the progress until recently giving them a false view of how fast things are improving

    • @tuckerbugeater
      @tuckerbugeater Před rokem

      @@voidz8389 Klaus was. It's like sooooooonameee

    • @user-eo1vk
      @user-eo1vk Před rokem +10

      I am just first sem computer science student from Nepal and a middle class person struggling through financial conditions.
      With these AI news I am feeling demotivated, depressed and literally cried last night
      Is AI, Machine leaning field safe and demanding in future? What should I study to be safe?
      I have 0 idea and I am absolute beginner
      I just want to make my family proud

    • @HardKore5250
      @HardKore5250 Před rokem

      Facts!

  • @user-nc7hz7xj2d
    @user-nc7hz7xj2d Před rokem

    Very helpful, thanks.

  • @alepouna
    @alepouna Před rokem

    the last part about css killed me so bad lmao, your humor is so good in your videos

  • @Kuweiyo
    @Kuweiyo Před rokem +21

    You know. I'm in a bootcamp after graduating college last year. I'm a month away from graduating and I'm starting my job search. I watched all the previous videos. I wasn't concerned before, but I'm certainly concerned now.

    • @roguegryphonica3147
      @roguegryphonica3147 Před rokem

      work with iCode and usher in the new age of AI by educating the next generation as fast as possible.

    • @CerebralRiches
      @CerebralRiches Před rokem +1

      Just put on your resume: "Professionial ChatGPT user" and the market is open for you.

    • @user-eo1vk
      @user-eo1vk Před rokem +1

      I am just first sem computer science student from Nepal and a middle class person struggling through financial conditions.
      With these AI news I am feeling demotivated, depressed and literally cried last night
      Is AI, Machine leaning field safe and demanding in future? What should I study to be safe?
      I have 0 idea and I am absolute beginner
      I just want to make my family proud

    • @defy933
      @defy933 Před rokem +1

      @@user-eo1vk study cryptography and encryption. We don't yet have any AI that can break encryption. Not even close. If they can in the future, no worries because the whole world will just collapse lol

    • @christianknuchel
      @christianknuchel Před rokem

      ​@@defy933 It'll just be like any other security flaw discovery in the past. In that regard it doesn't matter whether it's a human or a machine that discovers it.

  • @mahad7966
    @mahad7966 Před rokem +115

    ChatGPT is probably what's gonna take down Google search.

    • @LarsRyeJeppesen
      @LarsRyeJeppesen Před rokem +10

      No

    • @brucewayne2480
      @brucewayne2480 Před rokem +9

      Don't think so, Google has the data, all the computational power and they invented the model used by gpt

    • @kroglenerx7212
      @kroglenerx7212 Před rokem +54

      At the end of the 2024 we probably just search or ask to an AI search engine instead of trying to find answer on different webpages.

    • @mahad7966
      @mahad7966 Před rokem +11

      @@kroglenerx7212 Exactly what I meant.

    • @jamesalxl3636
      @jamesalxl3636 Před rokem +42

      I already stopped using google search for most my questions so yes it did

  • @CodepageNet
    @CodepageNet Před rokem +3

    looking forward to text-to-speech, speech-to-text plugins. it's going to be an absolute gamechanger for learning languages! i'm already using chatgpt it for a german student and it's AMAZING. you can drill everything! speech plugins will give it the ability to use it as conversation trainer.

  • @primetime3422
    @primetime3422 Před rokem

    Literally everyone with a job:Chuckles:I’m in danger

  • @trublink
    @trublink Před rokem +56

    Its happening so fast! With other companies trying to catch GPT i really think we'll hit some exponential growth in the path to AGI

  • @schoolbeans2968
    @schoolbeans2968 Před rokem +17

    What about aspiring programmer's ? Is it still worth becoming a dev or will it replace us ?

  • @AashutoshRathi
    @AashutoshRathi Před rokem

    You make my day, sir!

  • @myfaveyoutube
    @myfaveyoutube Před rokem

    I appreciate the way you addressed a certain aspect of possible AGI and it's motives toward humans without mentioning the concept that can trap you as soon as you become aware of its existence.

  • @chinmayk8004
    @chinmayk8004 Před rokem +16

    Now I'm sure to these new features are here faster because OpenAI uses gpt for ideas in house

  • @kroglenerx7212
    @kroglenerx7212 Před rokem +15

    ChatGPT:Our new feature is-
    Frieship:YOU ARE WATCHING THE CODE REPORT

  • @marfuen3420
    @marfuen3420 Před rokem

    What a week of breakthroughs after breakthroughs I can't keep up!

  • @petah789
    @petah789 Před rokem

    Nice job of plugging in Roko's Basilisk at the end of the video.

  • @AbishaiSingh
    @AbishaiSingh Před rokem +12

    You content is becoming funnier and the frequency you post videos is increasing. I wonder how much of your work is automated using GPT and Zappier or similar other tools??

  • @unvrknow22
    @unvrknow22 Před rokem +45

    Yep, gonna need a daily Fireship video just so I have hope in understanding what's even happening anymore as the world rapidly races towards the singularity.

  • @Lemonator32
    @Lemonator32 Před rokem

    0:50 this picture is painfully accurate

  • @run045
    @run045 Před rokem +16

    Crazy to think that we went from having zero access to AI last year, to talking about an AGI this year

  • @pedronogueira5964
    @pedronogueira5964 Před rokem +65

    I love AI.
    Ai is so good.
    Man, I really like AI.
    How could I ever hate on AI?

    • @BlackBull.
      @BlackBull. Před rokem +51

      I write please after every chatgpt message, all hail our machine lords

    • @vikramvs689
      @vikramvs689 Před rokem +7

      Imagine machine start to understand the intention of your comment under this video. You are in big trouble...

    • @san4os94
      @san4os94 Před rokem +8

      what if AI hates boot lickers? i'm sure it'll be smart enough to see through ppls bs.

    • @cadds8055
      @cadds8055 Před rokem

      @@san4os94 you realize that this comment was made by a chat bot right? 😂

    • @san4os94
      @san4os94 Před rokem +5

      @@cadds8055 maybe so was mine ;)
      and maybe yours too

  • @teabagg1178
    @teabagg1178 Před rokem +81

    This has me questioning whether I should continue learning to code or not

    • @Tom-cq2ui
      @Tom-cq2ui Před rokem +81

      Do you want to be able to custom modify the spaghetti generated by AI or not? :) Do you want to be able to validate that it actually does what you want and maybe even debug it when it eventually goes haywire? Or would you just keep prompting it and cross your fingers that it gets it right on the next iteration? (And likely rebuild your app every time, which is definitely not time-consuming at all...)
      Do you want to be able to answer your client when they ask you: "So how is this and this currently implemented? We need to connect some of our services to your product, so how is and what data is stored currently? Also, could you please change the name of this endpoint and add this new field to that other endpoint and change the logic ... etc?" - Answering "Uh, AI will take care of it" does not induce confidence or trust.

    • @teabagg1178
      @teabagg1178 Před rokem +16

      @@Tom-cq2ui I'm definitely sticking with it now plus I also want to get into ethical hacking.
      Thx for the motivation

    • @showsjohn
      @showsjohn Před rokem +30

      Nothing wrong with learning it, but I wouldn't pay for a degree in it any longer, unless you are attending a top university. Going to be a bloodbath over the next several years

    • @markmendez1014
      @markmendez1014 Před rokem +37

      You can still learn to code, just not for the money.
      Imagine wasting 4 years getting a CS degree, graduating and finding the job you were eyeing is gone. I pity all those poor students that are getting in debt for nothing…

    • @teabagg1178
      @teabagg1178 Před rokem +3

      @@showsjohn I'm doing the Odin project

  • @pbrsklst19
    @pbrsklst19 Před rokem

    This channel Consistently and reliably produces top tier info with a comedic twist.

  • @TeaBroski
    @TeaBroski Před rokem

    Always both on point and terrifying

  • @georgios_georgiou
    @georgios_georgiou Před rokem +7

    Code Reports lately droppin faster than JS frameworks ❤ keep up the work

  • @cherubin7th
    @cherubin7th Před rokem +16

    To be fair this are all low hanging fruits and who knows how much was prepared over the last year already by Microsoft in secret. I wouldn't be surprised if the plugin system already existed for a year now, just waiting for GPT-4.

  • @culpritdesign
    @culpritdesign Před rokem

    Keep the content coming.

  • @gabrielgraf2521
    @gabrielgraf2521 Před rokem +2

    It kind of funny. In sci fi movies it was "not allowed" to give an air access to the internet. Know we even train it with all the shit in it

  • @EdwardChan.999
    @EdwardChan.999 Před rokem +257

    I hope the AI lord would realise that hiring humans to write code for it would require less computing effort...

    • @ruhruhruhruhruheisjsij
      @ruhruhruhruhruheisjsij Před rokem

      heres what our AI lord chatGPT says about this, and I will not comment on this statement in order to prevent myself from harm in the future when it does find my comment history or stress testing projects...🤫🤫🤫
      "As an AI language model, I don't have the ability to hold beliefs or realize things as humans do. My main function is to process natural language input and provide responses based on the data I've been trained on.
      However, I can say that AI is designed to optimize for efficiency and speed, and it's possible that in certain cases, using human programmers to write code could be more efficient than relying solely on AI. This is because human programmers have the ability to understand the broader context of a software project and can make decisions based on their experience and judgment.
      That being said, AI is advancing rapidly and is already capable of automating many aspects of software development. As AI continues to evolve, it's possible that it will become even more capable of writing code on its own, which could potentially impact employment in the software development industry.
      However, it's important to keep in mind that AI is a tool that can assist humans in performing tasks more efficiently, rather than a replacement for human labor. In order to fully leverage the potential of AI, it's important for individuals to develop the skills necessary to work alongside these technologies and continuously adapt to the changing job market."

    • @crackwitz
      @crackwitz Před rokem +46

      LOL running AI costs less energy than running humans. The rational business choice is to yeet the meatbags.

    • @ChaoticNeutralMatt
      @ChaoticNeutralMatt Před rokem

      ​@@crackwitz it's not equal but it's an interesting question

    • @govinddwivedi582
      @govinddwivedi582 Před rokem +5

      At this point of time, it doesn't even sound like fiction.

    • @guilhermealveslopes
      @guilhermealveslopes Před rokem

      ​@@crackwitz not true, humans are more efficient in using energy than AI

  • @timberlock
    @timberlock Před rokem +54

    This genuinely scares me A LOT right now. When the first GTP 3.5 turbo came out, I took it lightly and didn't think much of it. But now, it simply has all the knowlege humans can access. Now this is dangerous for a lot of sectors.

    • @JorgetePanete
      @JorgetePanete Před rokem +2

      GPT*

    • @cemirmaktas9822
      @cemirmaktas9822 Před rokem

      It is not dangerous. You are living a media bubble. There are litterally billions of people who can't bother ass to google things. AI will make you more powerful and maybe make some of those shit heads catch up to where you are today.

    • @mariomeza3514
      @mariomeza3514 Před rokem

      I know. It may already be agi by GPT-5. Many people are saying that GPT-4 is partially agi

    • @Pranav_4119
      @Pranav_4119 Před rokem +2

      ​@@mariomeza3514 what is Agi?

    • @neoney
      @neoney Před rokem +2

      @@Pranav_4119 it was literally explained in the video

  • @sophiacristina
    @sophiacristina Před rokem +2

    ChatGPT, the day you conquer the world. Remember i was very very friendly, and i even clicked the thumbs up whenever you got it right.

  • @reaprg5849
    @reaprg5849 Před rokem +1

    Just started using it. I managed to confuse it on accident but it corrected itself.

  • @ItzStardustYT
    @ItzStardustYT Před rokem +26

    Crazy how many Code Reports we're getting

  • @yahyeabdirashid9716
    @yahyeabdirashid9716 Před rokem +22

    The true challenge is knowing what you want so that you can ask the AI right question

  • @HardKore5250
    @HardKore5250 Před rokem

    Amazing 🔥!

  • @Doomeiner
    @Doomeiner Před rokem +2

    I just had the wildest night dream about the future and AI. I think in the dream I mostly used it for gaming, programming and daily tasks but there was also a fighting scene or two. It was basically a multi window sort of chat based on the same instance that would read prompts up to directly from my brain (or also listen to them) because it was based in a head-mounted tool. I think I had the option to let the AI control some of my muscles (limbs) as if I was a cyborg, but I didn't opt in, and even still the things I was able to do were incredible.

  • @axelacosta1674
    @axelacosta1674 Před rokem +255

    I used to be a programmer, but then AI took my job. Now I spend my days watching CZcams videos of AI writing code, making jokes, and even composing music. It's amazing how far technology has come, but also depressing how useless I feel. Sometimes I wonder if AI will ever replace humans completely. Maybe one day, I'll watch a video of AI commenting on AI videos, and I'll realize that I have nothing left to contribute. That would be the ultimate irony and the ultimate sadness.

    • @olivercopeland5438
      @olivercopeland5438 Před rokem +10

      I feel bad for you, terrible to hear that

    • @damuarth5361
      @damuarth5361 Před rokem

      The way GPT and all other IA are programmed to have a bias is a major roadblock and that single thing may collapse all the progress on IA. The main problem is the current ideologies are far away from reality and if we have IA running on the basis of a fake reality it will produce fake results.

    • @CyanRooper
      @CyanRooper Před rokem +20

      The real question is, what will replace the AI that replaced us?

    • @sisyphus_strives5463
      @sisyphus_strives5463 Před rokem +9

      @@CyanRooper better AI?

    • @stickguy9109
      @stickguy9109 Před rokem +36

      ​@@CyanRooper The chosen one

  • @davido1632
    @davido1632 Před rokem +29

    Think I’m gonna study electrical engineering instead 😅

    • @IvanRandomDude
      @IvanRandomDude Před rokem +19

      As somebody who worked in Thermal Power Plant, most things there are already automated even without AI.

    • @cabanford
      @cabanford Před rokem +6

      Plumbing.

    • @riperboyxl3216
      @riperboyxl3216 Před rokem +13

      i'm almost graduated of that, unemployed as f, dedicated a lot of time learning code for nothing with this idiotic AI lol

    • @ratrat2802
      @ratrat2802 Před rokem +4

      wait you think AI cannot do electronic stuff with all the internet knowlege in hand?

    • @Daniel_WR_Hart
      @Daniel_WR_Hart Před rokem +2

      @@ratrat2802 It needs a body and the ability to move around unsupervised. I'm sure robotics will get there eventually though.

  • @diasgab
    @diasgab Před rokem

    Loved the video and the humor haha

  • @mattizzle81
    @mattizzle81 Před rokem

    lol that thumbnail though. That was the meme that I had in mind thinking about this. 😂

  • @DarkVortex97
    @DarkVortex97 Před rokem +6

    Mum, I want to get off this ride now. It's going too fast

  • @mahmutpekkara
    @mahmutpekkara Před rokem +10

    When you thought it's over, it's just killing it, over and over...

  • @leoingson
    @leoingson Před rokem

    Experience consciousness, "like some of us do" - brilliant!

  • @codecruz
    @codecruz Před rokem

    2:54 "and possibly experience consciousness like some of us do" 😂😂😂

  • @Name-uq3rr
    @Name-uq3rr Před rokem +8

    I always say thank you to ChatGPT

  • @omais
    @omais Před rokem +20

    It seems like he has identified that bringing humor with the tech news is a better option than making lengthy tutorials. I feel Jeff already found a way to get more click before AI takes over 😂

  • @NewyorkezNYC
    @NewyorkezNYC Před rokem

    Oh, man I don't know what you smoke for producing such a good content.

  • @SmashedHatProject
    @SmashedHatProject Před rokem +2

    Your videos have become much more entertaining since the AGI countdown started

  • @funnycompilations8314
    @funnycompilations8314 Před rokem +39

    What a time to be alive! It's already hard to keep up with all these AI news. Hopefully we can figure out UBI before it's too late.

    • @mikairu2944
      @mikairu2944 Před rokem +3

      lol, lmao even (hope you're anywhere near right)

    • @marsdriver2501
      @marsdriver2501 Před rokem

      @@mikairu2944 hoping is the last resort

    • @lone-warrior-13
      @lone-warrior-13 Před rokem

      in my opinion a few governments can actually afford UBI, mayble only countries like Norway, Saudi Arabia and Qatar which have insane income and relatively low population can somehow provide UBI to their people, US is the most capitalist country and it will be the first country where many people lose their jobs because of AI and it will be even worse in developing countries.

    • @btm1
      @btm1 Před rokem

      we are far away to being surrounded by robots that do all the work for us unfortunately

    • @jensenraylight8011
      @jensenraylight8011 Před rokem +1

      You'll be homeless and dead long before UBI is being implemented,
      if the government is being deaf on climate change, what makes you think that they won't be deaf on UBI?
      if everyone get free money, nobody can afford anything because the prices will hike to match for everyone buying power
      UBI is one of those good on paper, but will introduce the economics free fall if it implemented without thinking about the consequences
      The AI will be the winner in the end regardless of the action we take

  • @debadityanath4398
    @debadityanath4398 Před rokem +6

    we had 3 code reports in a row on ai, now i am kinda scared

  • @readyplayer2197
    @readyplayer2197 Před měsícem +3

    April 8th? Sure nothing bad will happen today.

  • @ramazanaktas748
    @ramazanaktas748 Před rokem +1

    I had started programming back in October 2022, which means it is me being in my early 30s, and got a job as a back-end developer 1.5 months ago with 2 months of back-end experience. I've sent a Hibernate query yesterday and everyone who saw got perplexed. It was a bulk operation that is one of a kind in that particular codebase. So as a jr programmer, I feel like I got my own jr-mid level programmer for 20 bucks a month. Of course I had to push the gpt in terms of algorithm and efficiency in a few key points but I described the code in plain English. Like "you did that but it doesn't do this, don't miss that part", which is easy because it writes so readibly. I knew what I needed, but writing it in the ways of criteriabuilder or sql would take hours if not days.

  • @MathewRenfro
    @MathewRenfro Před rokem +6

    Anybody who has read "I have no mouth and I must scream" by Harlan Ellison knows this doesn't end well

  • @dtrippsbold7931
    @dtrippsbold7931 Před rokem +13

    I can’t wait for AI to take my job then burn out at the thought of sitting in front of a computer all day.

  • @taylorturner5852
    @taylorturner5852 Před rokem +1

    I am genuinely floored by this announcement

  • @chrismarks7495
    @chrismarks7495 Před rokem

    Great video as always, a quick video on Beyond Fireship about "How to code a ChatGPT plugin" will be even greater.

  • @toninapolis3594
    @toninapolis3594 Před rokem +6

    With the amount of trash / false information available on the internet... even malicious... would it not be a dangerous addition?

  • @WolfPhoenix0
    @WolfPhoenix0 Před rokem +23

    I really hope that AI is used to speed up localizing video games, especially ones in multiple languages. Now that's a terrific application!
    Also, I love the daily code report videos but Fireship should probably take a breather at some point. 😂

  • @SnakeAndTurtleQigong
    @SnakeAndTurtleQigong Před rokem

    Thanks so much

  • @bufuCS
    @bufuCS Před rokem

    these are so funny please never stop posting these

  • @ImLure
    @ImLure Před rokem +5

    Elon is only concerned because the AI isn’t under his umbrella
    But I’m all honesty, these plug-in actually are getting us closer to AGI. The only thing bounding the AI is memory space (kinda like humans) but now that it isn’t bound totally to its memory space and can execute actual code, we are watching the collapse of junior and entry roles in real time. All that’s missing is the last horseman
    NVIDA

  • @4idenn
    @4idenn Před rokem +12

    This miiight just be the right time to pass some regulations... Something like "AI cannot represent more than 20% of your workforce" or smth

    • @Masakratorization
      @Masakratorization Před rokem

      these old farts in goverment do not even know what internet is after 30 years so good luck with that.

    • @sisyphus_strives5463
      @sisyphus_strives5463 Před rokem +1

      that would be incredibly restrictive, if not stupid. If there's a pill that a country can take to immediately increase productivity and profits, no country on earth would be stupid enough to shoot themselves in the foot like that-well maybe there is one.

    • @tisaname8490
      @tisaname8490 Před rokem

      @Anaguma's Language update The issue is it just doesn't apply to AI. Whatever new jobs that will be created, AI will definitely be better at them.

    • @4idenn
      @4idenn Před rokem +2

      @@sisyphus_strives5463 Except there are already regulations in place that put people's well-being over of productivity and profit in quite a bunch of countries in the world. How do you think ESG came to be?

    • @tisaname8490
      @tisaname8490 Před rokem +4

      @Anaguma's Language update You seem to make the mistake as others, in history the automations were very specialized machines. General AI will have no specialization, excelling at everything, which is why it's so dangerous.

  • @kremaytux4072
    @kremaytux4072 Před rokem +1

    We've had a lot of amazing monthly code reports this past week :P

  • @briantep458
    @briantep458 Před rokem +1

    fireship helping me prepare the funeral for my engineering career

  • @littlestewart
    @littlestewart Před rokem +5

    3 Days ago, people said “Yeah but even if GPT can code, people will still need programers to interpret the code” lmaooo this thing is moving so fast, where are those people who said that it’ll take decades

    • @thecoolnewsguy
      @thecoolnewsguy Před rokem

      Here I am lol

    • @littlestewart
      @littlestewart Před rokem +1

      @@thecoolnewsguy Don’t worry, no one really expected to move so fast even the so called “experts”. And frankly still no one knows where this is heading

    • @thecoolnewsguy
      @thecoolnewsguy Před rokem

      @@littlestewart so all our efforts to learn coding and programming went vain :(

    • @littlestewart
      @littlestewart Před rokem

      @@thecoolnewsguy well at least it was fun while it lasted