Why Farmers Can’t Legally Replant Their Own Seeds
Vložit
- čas přidán 30. 03. 2022
- Try Audible Plus for free for thirty days at audible.com/hai
Get a Half as Interesting t-shirt: standard.tv/collections/half-...
Suggest a video and get a free t-shirt if we use it: halfasinteresting.com/suggest
Follow Sam from Half as Interesting on Instagram: / sam.from.wendover
Follow Half as Interesting on Twitter: / halfinteresting
Discuss this video on Reddit: / halfasinteresting
Video written by Ben Doyle
Check out my other channel: / wendoverproductions
Yup, it's why during disaster relief in Haiti when Monsanto made a "charitable" donation of seeds, the farmers knew that they were being led into a system of reliance on Monsanto, so they piled up all the seeds they received and burned them.
Based farmers.
@@DeathsOnTheYAxis why give Monsanto and the US/Haitian govt a reason to come make some "interventions"?
@@DeathsOnTheYAxis because if you plant them for one year they will cross pollinate with everything around them. That means any seeds produced, whether on an organic farm or not, could contain patented Monsanto genetics.
@@DeathsOnTheYAxis correct, the video implies that large seed companies haven’t been *suing* many small farmers… because they don’t have to. Once the patented seeds cross-pollinate the plants grown on any nearby organic farm, that organic farm is essentially destroyed, unless the farmer wants to buy all new seed every single year. It’s not only about lawsuits.
Good.
In India farmers can plant seeds from the crop they have sown. Monsanto and Bayer tried to stop them, but Supreme Court ruled in favour of farmers that seeds can't be patented and you can't deny farmers planting seeds from their produce. Some have even crossbreed these patented seeds with generic ones and sell them cheaper.
Good!
Good to know there are some legislators who support the farmers in this.
In America corporations have bought the Supreme Court just to stop verdicts like that in the USA. It’s a reason Corporate paid millions to put their people on the court. Trump never ever heard of the judges before he appointed them. It was all decided by corporate America. Obviously in this instance India is less corrupt than USA.
@@vigilantcosmicpenguin8721 the small farmers in India are fighting tooth and nails for their rights. Did you miss the 2020 Indian farmers protests 250 million people took part in and lastet over a year?
@@jakx2ob People don't care what happens in shithole countries. Like how people weren't making a big deal out of wars in Africa or US bombing the middle east, but suddenly when some white europeans get attacked by russia it's everyone's problem.
If those protests were held in Canada, France or the US, we would have known about it.
its so insane that people can patent a raw food and get away with it
@Niglet9-11 its not only us tho... its almost for entire world
It would be antisemitic to stop the Monsanto family
I mean, they literally spent millions of dollars developing a seed that people would want to buy because it was genetically superior. So it is their very own developed variant that they have a patent
@@TheTiagones yah a patent that makes it so you cant plant your own seeds becouse if anyone around your farm is using thier seed they will come and sue you... its a blackmail worth millions of dollars.
@@ninjadamian1997 It says in the video that it has never happened. No one's been sued for not using their seeds. And if you care so much about replanting your seeds, you could just buy seeds from someone else
Took a botany class and my professor used to work for Lays potato chips. She said that their security was so intense while she had to go into the lab that they would have to do a full examination to make sure you weren't stealing any modified seeds to sell to competitors
Full examination? What do you mean by that? 🤔
@@StonedMukbangeven the butt
Like how in shows, you see people working with drugs in their underwear so they don’t steal any product
... Don't potatoes sprout?
Can't the competitors go and buy the seeds from the same place the farmers get them?
Lay's tried to sue some farmers in India for growing patented potatoes and took the case to court.The court ruled in favour of the farmers and now no company can hold crop patents now.
That's India. Here in Merika, the supreme court is squarely in Monsanto's pocket.
@@SeattlePioneer Farming sector in India is unorganised and largely unregulated. So what you end up with is lower connectivity areas using older seeds probably even centuries old and hyper connected areas end up with productive seeds. Add to it, the subsidies provided to farmers, huge no of seed companies, farmer vote bank and government bodies conducting the agri research. It is combination of everything, some farmers end up with low produce, some end up being one of richest, some companies bleed and some excels.
@@SeattlePioneer they can grow for own use but not for comercial use. So they can do for their own family, not for comercial sell. I guess local sell still happens but not big contract.
@@johndunn9819 Why should you not get a patent for inventing something that massively increases crop yields? Should tractor manufacturers also work for free or something?
The logic that 200 seeds equals 200 tomatoes genuinely hurt. 200 seeds=200 plants which probably have 20-40 tomatoes(large) and possibly hundreds (cherrys) so 200 seeds is more 1000+ tomatoes lol
Yeah but its also wrong in the opposite way aswell. I mean if you plant 200 seeds I find it very unlikely that you get to harvest from all 200. I doubt all 200 even sprout. I'm no farmer, but I dont think seeds have a 100% chance of sprouting
@@scottstroh2564 My patent seeds do sprout 100% of the time, trust me bro
@@lentilad *Source: trust me*
Add to that that 200 * 200 = 4000 somehow.
@@busimagen Two years ago I found some raddish seeds from the 1990s I had forgotten about (no, I hadn't forgotten *all* about the 1990s, only that I had bought those seeds and a few other minor details). I didb't get much yield from those seeds but I did actually get some raddishes.
---
That's nothing compared to the Judean date palm resurrection project though; they are actually using 2,000 years old seeds to grow a palm species that were supposed to be extinct.
It's called the MONSONTO protection act. It's a law that was quickly pushed (with considerable lobbying) to prevent farmers from using the seeds again.
What is MONSONTO?
@@davidebrownstlGoogle it
@@Solaamii Google didn't say, only shows results for Monsanto with an A.
@@daniel4647 oh my dumbass didn't realise what he meant💀
googleuser, you are repeating something false, that you didn't even remember right.
First of all, there was no law ever called the Monsanto Protection act. That's something that anti-GMO agitators called a certain law, although that law didn't have anything to do with saving seeds, and didn't mention Monsanto. But yes it is a law that Monsanto certainly liked.
In fact, it wasn't even a general law. It was section 735 of a "continuing resolution" which funded part of the government while Congress was trying to pass the final appropriation for funding some government department. And it only counted for the few months until that appropriation bill was passed, after which it became moot.
So what was that section 213 really about? It was about GMO sugar beets. By 2012, sorry if I don't have the exact year, almost all sugar beets grown in the US and Canada were genetically modified, something like 95%. These had been approved by all three US agencies that regulate genetically modified food, seven years before. They were also approved by the regulating bodies in Canada. But an anti-GMO organization brought suit against the US Department of Agriculture, claiming that the previous approvals were invalid because the Department had failed to file an environmental impact statement. In fact, the DOA had filed an environmental assessment. The trial judge decided that an environmental assessment was not equivalent to an environmental impact statement. He therefore ruled, just after the spring planting was complete over most of the US, that the sugar beet fields would have to be pulled up. This would obviously be costly to sugar beet farmers. It would also be costly to consumers because there would be sugar shortages.
Before you worry about whether an environmental impact statement would offer some extra environmental protection, let's make sure we understand what about the environment would be protected. According to the plaintiff, when the sugar beets have flowers and produce pollen, that pollen could drift or be carried by insects to fertilize other beet flowers, even organic beet flowers, making the resulting seeds produced by those flowers non-organic. This may have convinced the judge, but it was mostly nonsense. Why?
First, sugar beets do not produce flowers in the year they are planted. They could produce flowers, then seeds, in the second year, but there is no second year because the sugar beets are harvested in the fall of the planting year. So there is no pollen to fertilize the flowers of the organic sugar beets.
The only exception would be farms growing sugar beets specifically to produce seeds, not sugar. But all such farms in the US (and there are none in Canada) are in a small area of the state of Oregon, the Willamette Valley. Yet the judge ordered the sugar beets to be uprooted all across the US. That made no sense.
The US Secretary of Agriculture ordered an Environmental Impact Statement to be drawn up, but to do that without being contemptuous, it needed to be done right, a process that would take about a year. Nobody seriously expected the E.I.S. to be different from the Environmental Assessment already done. Everyone knew that the plaintiffs were really only making trouble for trouble's sake. So the judge's ruling was appealed. The Sec. of Agriculture also issued a permission for farmers to leave their crops in the ground until the appeal could be heard in court.
The law you are calling the Monsanto Protection act was limited to saying that the Sec. or Agriculture could do that.
When the appeal of the judge's foolish ruling was heard by an appeals court, it was overturned. I think the plaintiff tried to take it to a second appeal, but I might remember that wrong.
So you see, the law had nothing to do with saving and replanting seeds, protected farmers much more than it protected Monsanto, and was both appropriate and necessary. You also put in the phrase "with considerable lobbying", which contradicts the anti-GMO organizations claim that section 213 was sneaked into the bill without the knowledge of the chairman of the Senate Committee, Sen. Mikulsky of Maryland.
The seed control is one of the scariest things ive ever realized.
IT ALL ABOUT CONTROL OUR GOVERNMENT IS EVIL
scarier than the nazis?
Nazis didn´t control the global food supply so yes@@ohhi5237
@ohhi5237 to me it's about on par because it poses the same threat to peoples
@@ohhi5237 It sounds like something the nazi's would have have in place
I strongly oppose the ability to file a patent for genetic information, especially in a case, when you cannot prove that a specific mutation could not occur naturally. Even worse, if pollen from your patented plants is being transmitted by insects and contaminates nearby fields, it is ridiculous that the one who contaminated can sue the victim of such contamination. This is wrong, both morally as well as logically. The company must accept the risk of cross-pollinating other fields as part of their business plan. If they do not like it, then they should not do it. Period. The US is setting a very bad example for the rest of the world. The so called land of the free is creating modern-day slaves, when they strip farmers of their own seeds, which they had the right to keep and use for the next planting and harvest since humanity began with agriculture. The rich get richer and the poor get poorer. Disgusting!
people have free speech to plant seeds from the crops they grow.
@@SamSitar a plant isn't speech, and is therefore not protected by the 2nd amendment
Breeding/creating new varieties is expensive and without the patents there's no way to recoup the costs. After all farmers would only have to buy a handful of seeds and within a few years of replanting those they'd be able to grow fields full of them. Making them sterile to do it without patents only works with a small handful of high-yield plants that you can easily clone, like bananas.
The chance that new plant varieties are genetically near-identical to naturally occurring ones is bordering on the impossible. The genetic code is millions of base-pairs long and getting the exact same mutations in the exact same parts of the code without a ton of random mutations in other places just won't happen.
Monsanto is a terrifyingly unethical mega-corporation but as dumb as it seems at first the issue is nuanced.
It would be very easy to prove statistically that a given plant with matching genetic information to a patented variety could only have come from that variety. We're talking about exceedingly rare mutations here, while genetic modification allows you to splice in whole 100-1000 nucleotide sequences. The probability of similarities like that arising due to chance mutations is incomprehensibly low. That being said I completely agree with you that this whole suing people whose fields you contaminated thing is absurd and erodes the basic premise of the American legal system.
I think we can all agree that new, higher production crop varieties with beneficial traits are a good thing right?
If a company’s have no way of parenting seed they have no way of profiting on the development of new seed varieties. How can we expect companies to invest millions of dollars developing better varieties if they cannot be compensated for their work?
I’m a farmer and confirm that this is true, but there’s not point to waste expensive land planting seeds that aren’t meant to be seeds (I know it makes no sense.) Basically crops such as soybeans are bred to make more oil, so the seeds are less potent as seeds
The second-generation seed is mostly inbred, which means it won't yield nearly as much or have the same characteristics as the parent. That's what was used a lot back in the 1940s and earlier when the same ground yielded around 1/4 what it does now.
Thank you for the work you do making the food that keeps society running
So, uhh, where do the seed-seeds come from? Or is it more Monsanto's lawyers ready to grease your backdoor up?
I support and Protect Heirloom seeds.
@@Nope_handlesaretrash I thought (but I'm not 100% sure), that they make seeds like that by cross-breeding two other plants that will result in the desired seeds
2016 I moved to Kansas to keep an eye on a friend’s 900 ac., I quickly learned how it works… the property owner contacted with a local farmer/land owner with equipment, that farmer purchased GMO seed from Beyer, which he planted, then he purchased fertilizer from Beyer, then purchased weed killer from Beyer which wouldn’t kill the GMO corn or soybeans, at harvest time farmer harvested and sold crop to Beyer. Sometimes he would store the crop and sell when prices went up. Profit to the land owner was small.
Interesting note the corn you see as you drive across the Midwest is not for human consumption, it goes to corn syrup, fuel, animal feed, alcohol.
There are many companies even foriegn companies that sell everything that Bayer does. Your post is ignorant jlr3636.
The case in Canada it wasn’t 95% of the seeds were Monsanto it was that the Monsanto seeds pollinated with his seed and cross bred and this the specific gene they patented technically infected his seeds forcing him to plant “Monsanto” seeds. A large part was he had to destroy it for other farmers mistakes especially since once said they spilled hundreds of pounds of seed by accident on his field edge next to the public road
And Monsanto did the same in the states. I remember seeing a news program about how they tried to force a farmer to buy their seeds and when he refused, they bought the farms around his property and let the wind take over. Then they sued him for having their seeds or pollen in his fields and the corrupt, criminal, terrorist US government allowed a court to rule in Monsanto's favour and they got his land for free.
The US is the biggest terrorist country on the planet. Reagan funded terrorists in other countries, calling them freedom fighters. Bush Sr, as head of the CIA started wars all over the planet, not to mention selling coke and opium to fund their wars, but as prez-e-dent, he illegally invaded Iraq to kill Saddam and failed, so his dim witted son and the Republicunts made up WMDs so they could send in, terrorist US troops to get and kill Saddam and then they attacked NY, so they could destroy Bldg 7 which conveniently held databases of most if not all the governments crimes and terrorist attacks and blamed it on 8 camel jockeys training on monkey bars in the desert, with 8 weeks of flight school training so they could illegally attack and invade Afghanistan. An independent study was done to see how feasible this was and they invited pilots who had years of experience flying single engine and twin engine planes as well as former navy and AF pilots and not a single one of them could fly the 747 simulators, one pilot accidentally turned of the auto pilot when adjusting his seat and the plane crashed and another flew straight into a mountain side and those were only done after those in charge noticed that none of them could get the simulated flight up in the air, so they got the planes up, turned on the auto pilot and let the invited pilots to then take over from there and again, none could fly or land the planes. But terrorist, US Republicunts said it was 8 to 32 camel jockeys with 8 weeks or less training that did it. Not to mention that every high school chem teacher will tell you, that jet fuel which is essentially Kerosene, does not burn hot enough to melt steel beams and we all saw the melted girders at ground zero days after the attack
So, sure it wasn't an inside job false flag operation so they could invade Afghanistan, and JFK was assassinated with a magic bullet that turned around in mid air after being fired from Oswald's rifle ! The only ones who still believe that terrorist Murika is a freedom loving Democracy, are inbred, moron, Murkins ! I call them that because that's how stupid they are, also it proves what terrorists they are and how they wish to be the only country on the continent and probably the world. US of A is short for the United States of the Continent of America. The name of their country is the United States, making them United Statiens, not Americans. If their country is called America making them Americans, then why does their passport say US passport and not American passport, plus look inside and it says that the barer of the passport is a US citizen and not American citizen. Because America is a continent you inbred, moron, terrorists !!! And you war mongering terrorists calling yourselves Americans is offensive to every other country on the continent in both North and South America, which is why I call them Murkins, also call them Pubic wigs, which is called a Murkin. I won't rant on, you can look up Murkin and everything else I wrote to see I made nothing up, unless you live in Murika then you probably won't be able to access anything but right wing propaganda sites, or left wing, Femanazi, misandrist sites.
Sorry for the rant ! fellow Canadian here and I am pissed at them for everything mentioned above and so much more but one of the main reason is these inbred, moron terrorist tried to blame us, Canada, they said the so called terrorists came into terrorist Murika through Canada and got 8 weeks flight school training in Montreal, plus they were able to get fake Canadian passports so they could get into terrorist Murika using fake Québec birth certificates, which turned out to be more terrorist, Murkin lies. Again, sorry for the rant !!!
The farmer, Percy Schmeiser, said in public that the patented canola plants came to be present in his fields by accident, but he made a different statement in court. In court, he said that some canola plants had showed up in a corner of one of his fields where they had not been planted and where they were not wanted. So he had one of his workers spray that canola crop with Roundup to get rid of them. When the sprayed plants survived, he knew that they were Monsanto's patented variety, and he decided to save the seeds and replant them because he considered Monsanto's patent to be invalid.
Hey, it's like Ancient Egypt. The farmers were lent seeds by the government, and were required to send them back after the harvest (obviously using the new seeds grown).
Good Point!
And that's what made the Bronze Age world so resilient!
Straight from Historia Civilis, I see.
America is like Egypt in so many ways. The red, white, and blue. An Egyptian symbol for Uranus was the Star Spangled Man. We have our north and south kingdom and the civil war. We have obelisks and pyramids all over, and there are tons of reasons Britain, Switzerland, and the Vatican are Egyptian.
@@EsotericBibleSecrets we’re more like Rome. Steadily collapsing.
Two comments: This episode should be called "Half as Depressing." Also, I loved how freaky the talking Pepsi logo was.
Angry Talking Pepsi Logo was an HAI highlight, to be sure.
Half as Sick.
Nah, it's not half as depressing; it's wholly depressing
No, what's depressing is having half as much yield and everybody's starving to death. But at least nobody's making money breeding plants, right?
This topic has been one of the best probes I found so far to find out if someone is actually checking the validity of the bull* he heard from his hippie friend that does not want to vaccinate himself or he just buys it as it is. Oh, the evil seed selling companies, forcing farmers with guns to stock up on their inferior to natural product, we need to make a revolution quickly before people start reading books and realize how painfully stupid the common myths are.
The very idea of criminalizing growing crops is one of the most repugnant things I’ve ever heard of.
They would charge for air we breathe if they could 😂
I don't know about other crops, but throughout my whole life growing wheat in Kansas we kept a few hundred bushels from our best producing field for that autumns sowing. I will say there was one year Dad sowed our whole acreage with totally new seed and the next year was one of our best crops we ever harvested, although the weather conditions where nearly perfect that year also. If he sold any veriety it was only a small amount to some smaller farmer.
people like you get sued to shit by monsanto "ICH HABE ES NICHT GEWUSST"
It was probably one of the thousands of un patented seed varieties. Most of the seed from Monsanto you can't replant even if you didn't have to worry about legal bullshit. They sell mostly hybrids which are awful when replanted and lose alot of their qualities that make them desirable.
Wheat has very few varieties that are under contact. Maybe 10% of what seed growers carry have a signed deal to not regrow. That leaves 90% of varieties you can save back and regrow from seed you raised. You just can't resell it to others as seed unless you have it certified.
This feels like something you’d see in The Outer Worlds video game. One company owning the universal right to grow food on one whole planet of surviving colonists. What could possibly go wrong?
Oy vey, don't attack the Monsanto family, that's antisemitic ! 👃
Damn folks can’t go anywhere and be great😮💨
Man that game was GREAT, loved that plot. Very true, crap like this would be right at home there.
Bruh that game was crap
@@DameOfDiamonds delete your account 😭
Fun fact: it's not just plants that can be patented. Natural animal genome sequences can be too. For instance, some spider silk genes of naturally occurring spiders are patented presently. Human genetic information was banned from being patented in the US unless synthetic (such as genetic treatments), but I'm not entirely familiar about just how much can be patented from other animals and the like. CZcamsr scientist Thought Emporium actually ended up using semi-randomized, then hand-tweaked genetic protein coding for making his own spider silk that can bond with graphene and other materials while being produced from yeast; he had to do this in part due to genetic patents in the first place, but admittedly he also thought he could make spider silk with interesting artificial properties. Thankfully in his case, he made it open source, since he's against this kind of stuff being patented. Still, it's very interesting.
a fellow man of culture I see!
Truely an interesting person.
Making genome sequences open-source sound VERY interesting...
@@GameMaker3_5
The source code be like: CTGGAAGCTAGTAGCAGTCGATGACGAGCAGTCGATCGATGAATATCTCTCGACGTAGCTAGAGGACTGATGCATGCGCGCGCGGGGGAGGAGACTATGTCGTATGACTAGCTGCAATCGATGCTAGCTGATGAGAGAGTTAAAAGCGCTGAGCGCGCGTAGGGCTGCGTCGTCCTGGAAGCTAGTAGCAGTCGATGACGAGCAGTCGATCGATGAATATCTCTCGACGTAGCTAGAGGACTGATGCATGCGCGCGCGGGGGAGGAAAAGACTATGTCGTATGACTAGCTGCATAAAAGCGCTGAGCGCGCGTAGGGCTGCGTCGTCCTGGAAGCTAAGATCGATGCGGCGCGCGCAGTAGCAGTCGATGACGAGCAGTCGATCGATGAATATCTCTCGACGTAGCTAGAGGACTGATGCATGCGCGCGCGGGGGAGGAGACTATGTCGTATGACTAGCTGCATAAAAGCGCTGAGCGCGCGTAGGGCTGCGTCGTC
So if covid alters your genes can they patent your genes now?
Also viruses....
I worked as an Electrician in a Water Sewage Plants.
Some Sewage bake there slug, and older ones don't.
I was at one old Sewage plant. It had piles of Sewage slug laying around.
I noticed plants growing in the slug. Some of the plants were tomatoes, and some were water melons.
You see when people poop seeds it goes to the Sewage plant, and gets dumped. The seeds are in fertilizer and grow.
I don't know whether the baked Sewage seeds are destroyed or grow after being dumped.
Slug from Sewage plants is dumped in mined out strip mines to regrow the land.
Buying seeds from evil megacorp is also advantageous for the farmer, economically.
Higher sprouting rate leads to higher yield. Not needing to save a portion of the harvest for seeds on top of that. Eliminates the need to store and care for those seeds till next planting season. Also, the grain from the harvest is often sterile, eliminating the risk some may sprout in the granary, which shouldn't happen if you have proper humidity control and ventilation, but not all silos are kept pristine. That's why sometimes they explode btw (yes, really).
This was how monsanto came to have the world's food supply at their hands. They simply offered such a good deal most farmers more or less forgot how to keep seeds.
😂 where are you getting you information
Convenience is selling your soul in installments
All that being said, I've been a farmer my entire life using whatever seeds I can get. You can bet for sure I'm planting the seeds from the harvest regardless of what someone says. Those are my plants not theirs.
If I understand from the other comments planting and using Monsanto seeds multiple years will cross pollinate the species and destroy the crop ( but maybe I’m misunderstanding, also good on you FUCK MONSANTO and anyone who believes crops can be privatized)
Agreed fuck them
Yesss
Good idea admitting & posting that online! Hopefully you’re small time enough that they don’t come crack down on you…
@@se7enthedge382 He's provided literally no information about who or where he is, I think he's in a pretty safe position to admit what he's doing.
I'm not sure what state you're located in but here in Ohio I have met many many many farmers who continuously save backup percentage of their seeds that are purchased from Monsanto or Syngenta and replant them the next year. At some point the patent on older hybrid seeds fall off, and farmers are able to plant those once patented seeds.
So farmers are left with a dilemma do you buy patented seeds that will result in a yield of 200 bushels per acre of corn where do you use the older form of seeds that you can regrow and are almost free that will get you 80 bushels of corn per acre?
In the end they go with the first one and then figure out how many they can keep back for the next year without getting in trouble with their local seed dealer.
Yeah once patent expired those old seeds are obsoleted due to productivity anyways. The problem without these old seeds though, is there will be no bargaining power against a monopoly. Yes, you still need to buy from Monsanto but at least you have some bargaining power if you have an alternative like the older seeds.
Sad. So they do use monsanto crap. We all know monsanto doesnt care about your health, at all
The government has fucked up the corn industry. We don't even need to grow all of this corn we just do.
@@maggiejetson7904 did you really need to post that twice?
@@amosmoses5630 Gotta make that oh so green ethanol biofuel which requires more energy to produce than you get from burning it! If we were actually trying to be environmentally friendly we'd be making it from sugarcane where its actually a net gain rather than a loss, but then the corn industry would lose their monopoly on ethanol production.
You bought the seeds, you own the seeds and everything that comes from it.
I’m starting a garden and hopefully can grow it into a market garden business. I plan on only using heirloom seeds and save seeds. I look at it as a way to save money. I’ll be using grow tunnels and drip tape/soaker hoses to water. Another barrier not mentioned and out of scope of this video are the licenses you have to get to sell your produce. If I decide to sell at farmers markets, I have to get mandatory voluntary certifications that the market and state say I have to have besides a business license. I understand now why it’s so difficult to start your own business.
There are also some non genetically engineered crops that also fall under contract.
Also, some crops do not have a contract, but depending on the breeding method, you will have poor results of you replant them. Hybrid breeding is a big example. Sorghum almost never has a contract, but being hybrid, you don't want to plant its offspring. Corn, genetically engineered or not, usually is hybrid.
Some common crops that have lots of patent or contract free varieties are wheat, non genetically engineered soybeans, Alfalfa, heirloom vegetables, and plants for haying or grazing.
Yep, like you say pretty much every unique cultivar is subject to patents. So literally every seed producer has a patent on their seeds. So, it’s pretty much impossible for farmers to buy any kind of seed that isn’t subject to some sort of patent protection. :( Genetic mod or not.
Corn is a selectively breed (gmo) of maize, the old maize from native americand not European corn
What are the plants that nature made that fall under contract?
@@rttrttyan beans and corn
@@rttrttyan we sell some of our crop to seed companies that simply just bag them and brand them.
I'm a farmer (also a doctor). To get hybrid corn, you plant two different varieties in 6 row swaths. The daddy corn gets to keep his tassels because that's where plant sperm (pollen) comes from. The mommy corn holds out her silk and the wind blows the pollen to the silk. The baby corn will grow much taller and be more productive than the parents. To get a dual hybrid you start with a hybrid mommy and a hybrid daddy. But hybrids don't breed true. (basic genetics: look at Mendel's peas, and by the way, he fudged his data). So if you really want to, you can replant your seeds but harvesting will be difficult and you won't get anywhere near the yield you get from the hybrid stuff. It's true that Monsanto behaves just like any other monopoly. Alas, power always corrupts.
The corrupt seek power
@@herotime3726 bingo.
Yup, Mendel was a bad boy. He didn't know about crossover and decided his numbers should match his expected results. My favorite response to someone mentioning Mendelian genetics is "what, fudge the data so it fits our model?"
: )
@@troyclayton he was still right about most things though
It's always nice to see someone point out that Mendel is a _partial_ quack.
I've made like 5 papers about seed patents during highschool I love this video
I plant seeds from my plants in city parks and government property to spite the government. City hall probably thinks they got a wild pinto bean problem. 😂
🤣🤣🤣🤣🤣🤣🤣🤣🤣 funny ass prank
Imagine getting punished to regrow crops.
Go figure why there is food shortages across the world.
Edit: I didn't know that this would blow up like it did... I honestly did NOT know how controversial this was.
Note: I do recognize that there are other reasons why there is food shortages... Even before I made this comment, but as a pro capitalist I find it hard to understand why crops should be patented? It makes no sense to me when anyone can get their hands on the seeds, and can theoretically grow the crop as many times as need. Without anyone noticing. Which is possible.
From a random stranger stilling the seeds off a plant before it is harvest.
To a farmer keeping some seeds hidden away so he can breed them later to create a new crop breed.
To a child secretly growing a second generation to 10th generation of the crop somewhere for the hell of it.
Then you have scenarios where some of the seeds, like cotton for example, would accidentally start growing cotton on the side of the road.
I have seen it done before. In fact I'm trying to grow some road side cotton right now.
Also, if I cross breed it a couple of times, and inbreed it a few times to increase certain traits. I can create my own breed of cotton that I can then theoretically patent.
In the end though when it is said, and done, I still believe it is the dumbest thing I've ever heard.
Ikr? This is the kind of law that deserves to be broken. Hell. If it was me I’d plant the seeds anyway and give those specific vegetables and fruits to the homeless and hungry. These greedy corporate bastards can take their stupid patent laws and shove it.
Fight the power!
@@Traumaqueenamy Also there is no 'profit' its an equal exchange, or if you want to get really technical - sold at a loss. Farmers work for 'free'. Its up to tax authorities and courts to prove they have value which they can't do. Keep on farmin' and keep on ownin guns
@@Traumaqueenamy agreed. We need more laws that doesn't benefit the corrupt, or greedy.
👍
Profit. NO CORPORATE WEENIE GIVES A SHIT IF YOUR ENTIRE NATION DIES if it doesn't purchase their product.
This reminds me of a program introduced in Bali in the 1970s. The Indonesian government recommended a "technology package" of new rice varieties, chemical fertilizers and organic pesticides. As part of the "Green Revolution", this program claimed the new strain of rice would be ready for harvest a few weeks earlier than native varieties, and therefore the same field could be planted again more quickly. Rice is grown year-round as Bali has a near perfect growing climate all year long. The problem was the newer variety was more susceptible to insect pests. Not to worry, the company offering the seeds (undoubtedly paying off some bureaucrats to push the product), also sold the pesticides for their genetically modified rice. Many farmers couldn't afford that, and those that did buy it ended up harming the ecosystem. The native rice varieties are much better. Duck guano provides good fertilizer, and chemical sprays are not generally needed. Clean land, clean water. Healthy ecosystem. It's a great system that worked very well for untold generations over the millennia. But where's the money in that for Monsanto, Shell, and similar companies?
There engineering a food shortage
how much duck poop do you think there is in the world? modern fertilizers, pesticides and genetically modified crops are essential for an efficient agricolture. you aren't going to feed 10 billion people with "traditional" methods.
20 bushels of wheat per acre and 180 bushels of wheat per acre are a huge difference.
There are varieties of genetically modified corn that can produce 300 bushels per acre during a drought! it's insane! And that's all thanks to technology. The companies that invest billions of dollars in research and development deserve to be compensated for the use of their intellectual property.
@@matteomarino3511 We shouldn't have 10 billion people, honestly. This just goes back to corporations creating a problem they sell you a solution to.
@@matteomarino3511 You think Monsanto is feeding 7.6 billion. Stop drinking the kool-aide!
Suharto and the New Order really was a disaster for Indonesia.
There was a case in Canada (not the one you mention) where a farmer successfully sued (actually, counter-sued) Monsanto for "contaminating" his crops with pollen from their engineered plants.
In the case you mention the farmer used Roundup against the generation after generation of mixed seeds until practically only Monsanto's engineered strain survived.
BTW, many hybrid strains of, say, corn here in Europe are not patented, but indeed the subsequent generations lose what is popularly called "hybrid vigor". That is not explicitly engineered into the plants (although the manufacturers don't mind it), but is a natural side-effect of hybridization. So, planing a part of your crop is not illegal, but is still impractical.
FBI coming to my doorstep after crafting a seed maker in Stardew Valley be like
My farm still uses open pollinated corn and wheat as well as several other crops. We gave up modern soybeans and corn years ago. We avoid the big seed companies by just telling them to piss off.
Meeting the investigators with a shotgun is probably a great way to tell them to piss off.
Thank you for your comment, that is AWESOME. I've been doing a whole series on TikTok and people just don't understand . " Hippie Happenin"
Love it!yeah piss off click click boom!
I like you👊🏻🤣
Good for you! Those lower yields really showed them!!!
But Sam! If this is such a big problem for farmers, why don't they just grow non-patented plants? I'm a stupid loser and the only way I can make myself feel better is by sowing dissent in your comments section!
_perfection_
In a few years, they'll find a way to patent dissent, and prevent you from sowing it, without a signed contract granting you the rights.
THEN where will you be, huh?
Somebody had to do it.
My guess is non patented plants have much lower yield.
@@MoneyAwake Lower yield and not "Roundup ready." Meaning they have to "cultivate" (i.e., weed) their fields several times during the growing season.
Great video, instructive with good sense of humor
I had a friend who used to take a bunch of tomatoes, every year and remove and dry the seeds and grow his own tomatoe plants! Probably around a hundred or so a year!
I am a farmer. There are plenty “publicly owned” seeds. Virtually all corn seed is and historically has been purchased by farmers. Corn seed is a hybrid and even before genetic engineering, you couldn’t plant the offspring you grew. Wheat, barley, soybeans, sunflowers and lots others have public varieties available.
Huh? If you can't replant them, how do you get more?
@@obvfw
Hybrid plants are the mating of very different plant lines. The first generation cross is predictable - subsequent generations revert back to parenting lines unpredictably. The way to reproduce hybrid plants is to recross parent lines.
@@bradshultz8385 CZcams farmers need your help for sure.
@@obvfw Look up hybrid plants and look up Gregor Mendel.
Then look up seed patents and you'll find that farmers have been signing seed contracts agreeing not to plant the resulting seeds since 1930. EVERY farmer knows about seed contracts. GMO row crop seeds didn't come along until 1996.
@@obvfw Because you can. The only seeds you can’t replant are the ones actually developed by the big agritech companies. The reason people use those seeds instead of the strains you can use seeds from is because they’ve been genetically modified to be unaffected by herbicides and pesticides, meaning you can easily spray them to kill unwanted pest species.
I farm in Iowa (corn/soybeans) and yeah this “problem” exists. We buy exclusively Pioneer seeds because they own the best hybrids (also best service around our area), any hybrid they don’t want is sold off to smaller seed companies. Farmers actually can grow seed corn/beans. We grow seed beans which when we harvest them, are separated from the majority of our crop and delivered back to Pioneer so they can treat them and resell later. The way we farm now, on such an industrial scale, even if we wanted to, saving our own seeds to try and replant would not be worth the time and effort. You need storage and treatment facilities which is costly. The ease of buying from our local dealer is well worth not having to mess around with saving our seeds to replant. We just take our seed tender into town, get filled up, head back to the planter and fill it up. On a small scale, saving seeds is very important, especially in a survival situation. However, with the industrialization of agriculture it just wouldn’t make sense in the modern US farming economy
Thank you.!
When my grandfather farmed 80 acres with horse drawn equipment… saving seeds was reasonably easy to do.
Today’s farmers might be farming 800 or more likely 8,000 acres. Storing that much seed, keeping it safe from critters wanting to snack on it as well as preventing mold or mildew…. Sounds like a job for companies with massive mechanical equipment and huge storage space.
This is the most practical comment that I've read, so far.
@@tonyhemingway7980 thanks, issues like this get people all fired up but unless they are actively involved in agriculture, it can be hard to understand the reality of it for a farmer
Are they really paying farmers to destroy their crops, making it financially unviable for them if they do not do so? Are they really quarantining and killing chickens nationwide just cause some tested + for bird flu on a pcr test?
@@heathergballew6106 Nobody is paying farmers to destroy their crops, at least in Iowa. Just the concept of that really doesn’t even make sense financially for either party. As far as chickens, thats reportedly happening in larger factory-style chicken farms. We actually have one nearby to us, but I don’t believe they have experienced bird flu issues. However, the ones fighting this problem, probably did kill a bunch of chickens. But they are chickens and millions are killed everyday for our consumption anyway. It’s a chicken, I wouldn’t worry too much about it unless it becomes a true epidemic that causes shortage. Which it probably won’t amount to because of the precautions these companies are taking.
Jesus, the transition into an ad was so seamless
"I like reading in theory", that's scarily relatable. lol
kind of an evil law..
VOTE
@@pfzht Voting doesn’t do shit cause all politicians care about is their own selves, gathering more votes near election time with false promises to stay in power and the short term money gains. there is no politician in the world that cares about the actual people/citizens
@@Mrgodzilla1990 indeed. Since voting is broken and we all acknowledge this as an observed fact of the 2020 election, let's talk about the recourse options available to us, with all this in mind.
@@pfzht as far as i can tell, from all the evidence. Seems Trump lost 2020 legally. Sucks to be you buddy.
We live in an evil world....
There are plenty of farms here in Utah who save there seeds and we even have seed banks (open to public) in state funded buildings like libraries. They are called Hierloom seeds.
Yup, it was never illegal and unless you are aggressively bad at seed saving patented plants are no legal concern. The reason most farmers don't grow heirloom varieties is that they amount of extra money they make growing modern varieties dwarfs their savings from growing saved seed. A farmer growing an heirloom dent corn like Bloody Butcher or Trucker's favorite would be really lucky to break 80 bushels an acre even with modern agricultural practices while modern hybrids are delivering double that. Heirloom seeds are important from a cultural perspective, and for variety of growth form, and flavor, and germplasm for future improvements; but most corn and soy are agroindustrial feedstock. The cow or ethanol plant consuming the field corn isn't going to appreciate that someone carried the seeds in their petticoat from St. Louis to Salt Lake City.
@@opcn18 There is actually a big market in Utah for Hierloom produce. Not corn or wheat though, god no. Things like tomatos and gourds are pretty popular heirloom varieties - but you pay good money for them, they are never in the standard stores, not in uniformed sizes, incredibly low shelf life, seasonal, and you usually have to travel to the farm. Plus, no way to scale the operation. But, they taste so good. Nothing like a big ugly purple tomato or warped yellow beet.
@@christopherross8358 Heirloom tomatoes are popular everywhere but it's really hard for farmers to turn a profit on heirloom tomatoes just because so much of the yield is lost. There are modern hybrids being produced which taste similar to heirlooms (aren't the red tennis balls that are normally sold in stores) but crack less and are resistant to more diseases.
@@opcn18 Nice, I think I've sen those variaties. Mostly Farmers who grow the Heirloom tomatoes have a diverse crop variety and have seasonal troughout the year. I know one farm that grows the best Tomatoes here grows peas, rhubarb, pumpkins, and tomatos. They do pretty well
@@opcn18 Good management creates good yields, even with the heritage. Greenhouse growing tomatoes help if you are in a very wet climate which causes bland tasting or cracked fruit, but many places are in ideal outside growing conditions and support themselves only selling those heritage tomatoes or heritage peppers on their small acreage. I took some Cornell Small Farming classes out of NY States agricultural department and they gave great tips on increased yields with intercropping trap plants to lure away pests and planting pollinator friendly plants to increase pollination. Also pruning to open air circulation to limit fungus or disease. You alternate/ rotate plant beds to decrease viruses too.
This is so much much of a interesting content for such a short video!
Some plants arent true to seed sort of. Ive been gardening some and noticed that my strawberry plant came back this spring but the strawberries werent good. Ive heard that there are other plants too that its better to transplant off the original plants instead of growing from seed (unless you buy the seeds)
Buy heirloom seeds and start growing your own food, people. Lots of ways to do it even in apartments and houses.
Inflation and supply disruptions alone should be enough to get people into becoming more self-sufficient. 🤷♂️
That's why my goal isn't to buy a house... it's to buy land. I'm so sick of evey aspect of life being monopolized.
@@jamesgizasson same
@@jamesgizasson make sure you know what you can and cannot do with YOUR property.🤦♂️
And just make sure you conceal your lawful usage. Don't expose water catch system, ETC.
You do not have "reasonable expectations of privacy" outside of your home on your own land and that's the biggest crock of crap.
@@dardarlizard Knowing the rules going in is probably going to take more effort than actually finding land! X3
Although, I disagree on keeping it hidden. I wanna put that all over CZcams. I intend to build a small system that can be made and maintained by one person with common materials and little training.
I hope everyone goes this way, but realistically no one will. It requires work! X3
Not even slightly practical for 99% of Americans.
I tried serious gardening in the way back. The time involved to get a few veggies against the odds of insects and diseases is huge.
Yes, it was wonderful to have super fresh corn and tomatoes. Again, a huge labor input. From planning to watering, to harvesting.
Key word her is "legally".. when my grandpa (a farmer) told me planting the crop he harvested is illigal I couldn't believe it. A lot of farmers apparently still planted their own illegally a lot but the yield is much worse so its more rare these days
I suggest you to delete this comment so that no company that owns these patents can find your grandpa through this comment to sue him
@@samuelleandro2275 and what exactly could my grandpa get in trouble for? If you read my comment you would know I said nothing about him doing this. So I can only assume you're saying Monsanto will track him down for knowing other people that may have planted patented seeds years ago?
@@jakek6728 Yeah, maybe I'm just being overly cautious XD
Also, I misunderstood it, I thought *he* planted and harvested it, but that seems to not be the case
@@samuelleandro2275 my grandpa would never do that ;)
As I understand seeds from GMO plants are less fertile. Guess you could alwaus try to buy seeds from an Amish farm but there is still the issue of you getting their seeds from nearby farmers.
Bandanna Shiva is a seed freedom activist, also look up the Open Seed Savining Initiative. Heirloom seeds and Open Pollinated seed varieties are the only way to defeat the Monsanto madness. Locally grown open pollinated seeds adapt to their local conditions, and landrace cultivation takes this to another level.
"You'll own nothing and you'll like it"
“You’ll complain about it, but you’ll do NOTHING about it”
Eat the bugs bigot
"In fact, half of you will actually praise the corporations holding you down"
Aaaand, on that list.
Klaus Schwab to blame
Monsanto no longer exists. It was bought by Bayer (yes, the aspirin company) for a ridiculous amount of money and is now Bayer Crop Sciences
Patents are still in place tho
Bayer, is an even larger, more evil corporation yay. GM jabs anyone.
Didn't Bayer produce the gas Zyclon B for the chambers?
In the UK there are virtually no GM crops grown because Monsanto could not guarantee that pollen from their plants could not cross with other crops, which would make seeds, and crops grown from them, from (for example) an organic farm worthless as the genetic material would be contaminated with modified genes. They could therefore be sued for destroying a genetic lineage. So having patented pollen bites both ways.
This guy got the cadence of a tier list channel but he also got the edge of a culture tuber. A++++ grade sarcasm
Heirloom seeds can be planted year to year with predictable results, they have a stable genome. Hybrid seeds are designed to produce a single crop and that's all ( One and done) the resulting assess possess an unstable genome, just try and plant sees from non Heirloom seeds and the resulting plant will be nothing like the Original fruit you collected the seeds from.
As an expariment, I planted some seeds from a package of "Grape Tomatoes" I bought at the store, as the fruit was quite nice... The resulting mutant monstrosity grew almost five feet high and six to eight feet wide, was loaded with small leaves, produced few flowers and the resulting mute-fruit was Bobby and had almost no seed cavities it was just solid flesh and practically tasteless!
I have been growing tomatoes for decades and this was the most bizarre Frankenstein experiment I have ever encountered! Which is why I only plant and harvest open pollinated Heirloom seeds.
The choice for determinant or indeterminate depends on a few factors, weather you want one big harvest all at once, then the plants die or indeterminate meaning individual fruit ripen at different times during the growing season and the plant is killed off by the frost in the fall. (FYI this to plants will keep producing fruit as long as growing conditions are favorable. So with a greenhouse you could harvest indeterminate tomatoes indefinitely. Something to think about...
Addendum:
Seeds planted year to year in the same location adapt to the local growing conditions so you get better harvests over successive years. IF you maintain soil fertility. And PH levels conducive to the crops you are growing.
As a side note, potatoes are an easy to grow nutritionally dense food crop that can be grown from sprouted store bought organic potatoes. So the next time you find a sprouting potato, plant it on a five gallon bucket of potting soil and enjoy the experience of growing your own food!
Thank you for your comment I've been doing a whole series on TikTok and people just don't understand . " Hippie Happenin"
Did you eat it?
@@MangaGamified he did say they taste terrible
You have piqued my intrigue. What is your Frankenstein tomato story. How did it turn out. I'm so intrigued from that comment.
My grandfather did up until the 70's. He reseaded his seeds from grain they had been growing for long before I was born.
Even caught the Wallows county grain grabbers buying his crop for feed and reselling it for seed.
he would also grow his hay from the same seed and feed it during the winter to the livestock. Mostly wheat and barley.
Don’t forget the „convenient“ seedless varieties of fruit and veggies that keep Average Joe from making produce on his own, even if just for fun.
Brother you can buy seeds online for heirloom crops and they ain’t owned by Monsanto and nobody is gonna sue you for saving your seed. If your source of seeds is super market produce you’re doing it wrong anyways.
This is why most hobby farmers use heritage breeds of plants, the are essentially the creative commons of the plant world. Actually heritage crops and plants are protected by law to prevent patented crops from accidentally cross pollinating them if the person growing the heritage crops is part of an organization that is part of the preservation and cultivation of heritage plants. Back in 2015-16 Monsanto actually got in pretty big trouble because they knowingly were growing crops too close to farms that were cultivating heritage soybeans and corn and then suing those farms for collecting seeds with the cross pollinated patent. Unfortunately they did that to one of the farmers who was also a lawyer for one of the heritage preservation groups and he coutersued them and won because his endangered and very rare crop of heritage soybeans was worth a *lot* more than the patented crops (because it was specifically for propagation of seeds) and was protected by law as having higher priority than hybrid/patent crops.
Just file a restraining order for them to keep there pollen out of your fields, then if they find anything in your fields you can use it against them in court.
Ah yes, a major mistake in the first 20 seconds. Because 200 squared equals 4,000, according to HAI...
Maybe he implies that you eat the rest
@@nohzatino9629 That's alotta tomatoes!
It's really depressing how stupid the entire culture is at this point. Plants, HOW DO THEY WORK?!?!??!?!?!?!
Also the assumption that a single tomato plant would grow only a single tomato. I'm sure that's not how tomatoes work.
Percy Schmeiser absolutely planted Monsanto products in his field intentionally. What had happened was that a nearby field contaminated his field, he only found out after spraying the edges of his field and those plants not dying. He then took those plants to seed, and used their seed to plant in his next seasons field, so he could spray the entire thing and not worry about dying crop plants.
In Canada, you cannot be punished if your crops are accidentally pollinated by crops from another farmers field. He was punished because he lied about it, and did it intentionally.
In the us you can if you have a permit from the owner of the original seed but doesn’t make it any easier to use your own seed because you still have to clean and dry it
I remember some years back pepsi filed a case in india regarding this. They gave contract to farmers to grow potatoes of specific breed invented by them.
Court gave judgement in favour of farmers.
Now we can see those extra large potatoes in local indian vegetable shops.
People generally try not to purchase those if possible, they are tasteless, just like imported onions.
lol umm just WTF
Erm, Pepsi? As in soda?!
@@nickyoung9108 pepsico owns lays
Indian court favoured Indian farmer, what a surprise. If you took a contract, you should fulfill your obligations. But, that’s why India is a third world country
@@smalhazi India is a third world country because it didn't looted and plundered other countries, and enslaved people from africa to do the dirty work, like the first world countries did.
I also wanted to remind everyone that you can *still* use seeds that aren't patented, which is basically everything that hasn't been a hybrid or modified by a company.
They don't use them because its cheaper to buy new seeds every year then plant plants that don't necessarily work as well.
BS on that. Bush Jr. allowed them into the National Seed Bank. The system allowed them to patent hundreds of heirloom seeds. We no longer own shit.
@@awen777
Just when I think I've read the most bizarre conspiracy theory that there is... someone comes up with a new one.
Where did you read this?
There was a huge uproar over this amongst the organic farmers. Patent fees are buried in the package cost.
@@awen777
Why did you never respond to me asking you for your source?
Is this one of those made up conspiracy website sources? Kinda like 9/11 truthers? "No, really... GWB let Monsanto into the seed bank and let them steal heirloom seeds!"?
@@awen777 Say what? Organic farmers can't use seeds that have any patented traits. Which shows how absurd the premise of this video is.
This video is a subtle cocky sting and I love it
10$ for 1 tomato I didn't know the inflation was that bad! 😅
Half As Interesting: the channel that demonstrates the inverse correlation between how relevant a topic is and how enjoyable it is to learn about.
So, just for clarity since it was mentioned twice in the video, farmers don’t throw out their seeds. The seed is what the farmers are growing the crop for. Farmers grow corn, and collect the kernels and *sell the kernels* to end users. The kernels are the seed.
The point of the video obviously still stands. Farmers could replant their harvested soybean seeds, but are contractually forbidden from doing so. But no one is growing a field of soybeans to harvest the beans and then throw out those beans. The beans are the end product
It's just baffling that these organi-tards are really that stupid that they think farmers grow a crop to throw it out. I swear this whole thing has nothing to do with corporations, and everything to do with city folk wanting desperately to believe that they're smarter than farmers.
wow, clueless.
Well actually, the seed manufacturers grow the soybeans just to get the seeds. But yes.
They should just anonymously spread the seeds everywhere all over the country. "Oh shoot, can't put the genie back in the bottle TOO BAD"
I bought tomatoes at the store and planted the seeds 😂
Screw corporations with their seed "ownership"
youre using their copyrighted dna and can go to jail for it :)
love these dumbasses explaining their crimes on youtube
This is genuinely entertaining from the sarcasm alone, well done. The fact that it also happens to be informative is a little extra on top
As I worked as a student in a seed "manufacturing" plant for a few sommers, two things to consider:
1) A lot of seeds today are hybrids. If you cross two different stains of crop, the next generation will be much stronger, but only this generation. So replanting them would give pretty bad results.
2) Developing and producing seeds is a lot of work (at least in Germany). Planting/growing/farming seeds requires to obey a lot of rules, f.e. some distance to other strains etc. Your fields will be checked by the government regularly. In every further steps samples must be taken and analyzed, reporting to the government agency that these seeds are indeed the strain they are expected to be. After harvesting, the seeds must be dryed, purified (stones, dust, crop residuals, weeds), a mordant is applied (very expensive but important, often protecting the seeds against birds, containing herbizides, sometimes fertilizers/minerals), packaging, ... and every step comes with labour, samples, laboratory, a lot of paperwork etc
A neighbor of mine when I was a kid used to raise corn and grain sorghum for seed companies. To make sure that the plants were only fertilized by the right plants, they would have to go through the field and bag the tassles. It took a pretty good crew to do all that.
If we didn't do this, there would literally be like 4 BILLION PEOPLE starving to death right now. But hey, at least nobody would be making money off plant breeding.
@@ericjohnson5969 Tassle bags: corn condoms?
@@frankroberts9320 we usually just cut plant;s pp off.
There is a huge amount of Science and work for the development of seeds, it's not as simples as the video showed. I work with maize, anyone can make their own maize breed, but without years of research and a lot of technologies that most people don't know about you will never be able to make a hybrid with good yield...
In eastern europe you can buy seeds whatever you want and you can do whatever you want to do with them, never heard about their corporate greed here.
This is the reason I only grow old heirloom varieties in my garden.
To summarize: it's not illegal for farmers to replant their own seed as long as it's not a patented variety of plant. Patented varieties tend to be more pest, disease, and herbicide resistant (because they are "GMO" by the way), which is why so many farmers use them. They probably make more money by purchasing the seeds each year since the non patented varieties don't have as large of a yield, anyway.
you can plant patented plants on private property.
They'll go after you if they detect their genes in your crops though. Like, say a farmer next door grows tomatoes from Monsanto, and you grow tomatoes that you've cultivated in your family for generations. There's natural cross pollination and next year's seeds are part Monsanto tomatoes. They can go after you for patent infringement (this has actually happened, a guy and his family had to destroy generations of work).
@@AdaptiveReasoning no. It hasn't. Reread the case. The guy found canola that had cross pollinated with the neighbors herbicide tolerant canola. He then singled out those plants and tried to create his own version. That is not the same.
@UCIuIBExCVRZ9JXjrXc5A27g in usa maybe ... , there is also a lot of farmer that suicid in poor country due to these kind of stuff being either expanssive or imposing too much constraint, etc etc.
Also there is many farmer or garden owner that dont use gmo plant , in france for exemple many like old variety cause they taste better, have different flavour or are bigger and not that unproductive or weak as some would make you think ..
AdaptiveReasoning If your tomato seeds are showing a high incidence of a neighbor’s GMO genes in them then something is going on, tomatoes aren’t really likely to be that cross pollinated and usually pollinate themselves.
Small and even medium time gardeners can easily become self reliant by planting and saving seeds. Tomatoes do especially well and replant from seeds quite good. Get some best boy plants and just save the seeds
That's called control at the highest level. And people cheer with glee.
Hybridised plants with mix and match roots and stems also only give seeds for the top part so yield is bad because the roots don't give it enough resources.
The idea that a type of plant can be thought of as someones intellectual property is insane to me.
In capitalism, Any stuff that can make money can be made as intellectual property. If it gets bad enough, even air will be an intellectual property
Why? These companies spend huge amounts of money on research and development.
Anyway, if you don't want to buy the seeds you don't have to.
They did modify the plant though.
3:37 bruh
Insanity doesn't exist in capitalism.
Oooooh I love this one. I worked on a farm 2 winters ago and as I was doing my tasks, I noticed a couple pallets with the Bayer logo on them, same logo that’s on the side of an aspirin bottle. I asked the farmer what that was about and he explained this whole process to me. It was super interesting.
So, this is where the plot of Jurrasic World Domion came from.
Witnessed Monsanto ruin a very well respected 10th generation family farm operation in Indiana over seed cleaning!
I worked at a flower farm (plant nursery) where they do try propagating a lot of their plants for selling, but only the ones that aren't propagation-prohibited, which ended up being some not-so-common variety of plants/colors that they had to just buy straight from the company who owned them for selling.
0:17 200x200=40,000 not 4K and that does not even consider that a seed can grow more than one tomato.
2:56 Any restaurant actually can make a Big Mac. They just can’t ever call it the same name as it violates trademark
This is why you team up with a near by farmer and swap seeds when you do your rotations
*it's all about control...setting the stage for widespread famine when these newly modified seeds become susceptible (by design) to an equally modified wind borne blight that decimates crops and leaves the farmland poisoned for years...leaving only very select areas free of the contagion...leading to massive food shortages and resource based riots*
You on meth bro?
Exactly it's all about control, just like the Oil price hike today
The video literally just stated "people can't be billionaires with crops if farmers replant seeds". It isn't a secret they want monopoly.
@@Max501 these people aren't just successful people conquering the world through success. They are part of the bigger scheme of things, they're evil, and they want a new world order that their kids will rule. It's no surprise, do you think people like Hitler, Mussolini, Stalin, or all of the big gang leaders from back in the day just disappeared? No they got smarter and went underground into the government and became "elected" officials. They run us.
No man it’s just about money, nothing else. I don’t know why y’all make those kinds of theories, why would they want that when they already got a good thing going here?
I lived in a farming area where a bunch of farm fields got flooded for a couple of months. The farmers couldn't plant anything. Once the fields dried out, canola started to grow (fields were canola in the previous year). Monsanto came through and sued all the farmers for growing their canola without a license/contract even though the farmers couldn't get on the field to til and replant it with another crop.
Please provide evidence to support your claim.
Monsanto spent decades convincing everyone round up was totally harmless to humans, bio degrades in the soil in days, yada yada. Only for it to be highly cancer inducing, especially in people with long term exposure. Monsanto got bought out but I would not cry at all if everyone of them disappeared in a boating accident somewhere. One of the most evil companies on earth.
@@heartysteer8752 I am pretty sure no one elected you "judge of the Internet". What have you done to find this out yourself?
@@ricahrdb This is a topic I've been watching some for close to 20 years and I've not heard this claim before. I did a little searching before asking and didn't find anything to support it. Given that no location is given, pretty hard to find much out. Over the years I've found that 99.99% of claims aren't true at all or are grossly misrepresented. If STMUN knows something I've missed, I'd like to know about it.
@@ricahrdb I think that Steer just wanted to see if these Stories are True or not.
My uncle taught me how to save seed from our harvest. We planted only heirloom seeds. We never purchased fertilizer, we made our own organics fertilizer from cow, chicken dung, and fish guts from a fish processing plant! We never purchased herbicide, we made it from natural ingredients!
The seeds are genetically distinct from the original plants. No child is a clone of a parent. But these same genetic changes can weaken or kill the offspring of engineered plants. Cross-contamination could also remove protections from patented crops. This could lead to lower yields and ultimately, the death of the engineered plants _en masse._
There are many mistakes in here but the main is that most plants are crosses of distinct mother and father plants which by themselves have a lot bad traits but together have the best traits possible. When a farmer decides to regrow using seeds of their crops they will end up with a mix of bad traits of the original parental plants. (Source; me, a plant researcher)
The ironic part is because of current events everybody's debating on whether or not to keep this law.
It's looking like companies might lose the opportunity to keep patents on plants
I don't think patents should be a thing, but that's not the same as being the owner of a specific bunch of seeds. Without patents, it would be legal to *copy* the design of the GMO, but still illegal to use "purchased" (rented?) seeds in a way not allowed by the "purchase" contract.
This should have never become law
All patents and copyrights should be public domain after 75 years at the very most. I say 75 years because that is one human lifetime for the patent owner or copyright holder to generate money from their work. This 75 year period starts from the first moment the first holder or owner claims it.
@Bampa Actually the max is 10 for Some types of Pattins.
The issue I have is with the organic ones.
In the process of making organic pattens by companies May go through a process which ends up destroying be natural.
So much of our food is owned by companies.
That is an invasion A slow invasion but still invasion.
It systematically cuts out independence Forcing codedependency.
The education system doesn't make it any better.
Economics was supposed to be a choice in this country it wasn't supposed to be forced on the people....
That's the opposite of the definition of a free market.
When do these patents run out or go open sourced?
"... and if I planted the seeds from those tomatoes I would have 4,000 tomatoes."
Actually, 40,000 not 4,000. And then the next number should be 6.4 trillion not 320 billion.
I want to believe that somewhere out there there is a branch of open source plants that are free for everyone to replant but have a reverse copyright that prevents you from selling a modified version of them or selling them at all, but you can replant them forever
Look for Heirloom varieties, that's basically what you described.
Why don't you get busy and do just that ----- for FREE! You would have to get yourself education in agronomy, conduct research, buy buildings and such to store the seeds, and you reward would be....
Non monetary.
No one is stopping you, after all.
If genetic information is patented, aren't one's parents entitled to a fee from businesses that employ their children?
The human genome can't be patented and if it was, it would conflict with human rights, so I doubt anyone would even consider a case like this.
It would make for an interesting short story/novel, so take a shot at it if you can lol.
@@ionpopescu3167 It is tho, there are specific genes patented right now that we probably didnt know were patented to begin with. Say hello to your new cooperate shock collar
They just fully synced the human genome, so there's a large possibility of it happening in the next 5-10years
Big Business: "By golly, you're right!"
Big Business terminates its entire domestic workforce and replaces it with workers from a nation with less restrictive copyright laws.
Big Business's smaller competitors who can't afford to offshore their workers go out of business.
@@Jacob_Overby What do you mean they fully synced the human genome?
This was in one of the comments by @TheWhiteDragon3:
Yup, it's why during disaster relief in Haiti when Monsanto made a "charitable" donation of seeds, the farmers knew that they were being led into a system of reliance on Monsanto, so they piled up all the seeds they received and burned them.
There were a huge number of responses, but none pointing out that it was false. Here's some background:
There was a devastating earthquake in Haiti in January of 2010. Many nations, companies, and individuals offered various kinds of help. Monsanto Company donated a lot of free seeds to Haiti. Some anti-GMO activists spread the false rumor that these were genetically modified seeds. A peasant leader, Chavannes Jean-Baptiste, organized a protest march. During that march, which was before any of Monsanto's donated seeds had even left the US, the march participants symbolically burned some seeds.
A few days later, when Chavannes Jean-Baptist learned that he had been duped, he apologized to Monsanto and to his followers.
Like so many anti-GMO falsehoods, the false story is just too good to let it go and with help from "useful idiots" like TheWhiteDragon3 this false story lives on.
"Sell each of those tomatoes for 10 dollars at the farmer's market" lol
“Sell each tomato for 10 dollars “ Tomato’s are like a dollars a piece 😭😭
I already knew this, but the way Sam explains it is so delightful that I was happy to watch this while I ate my lunch. Thanks and good job Sam.
Oh, I know this one. Seed patents are... something. I'm not entirely sure how I feel about them, but the entire concept seems at least mildly dodgy - but especially with genetically modified crops the idea makes *some* sense.
cool pfp
There has been cases where birds brought genetically modified seeds and dropped them, and they’ve grown on farms, at which point those farms were sued….
@@Meatball2022 yeah, I'd heard about that. That's the point where it obviously crosses a line and goes too far, but on the other hand the general idea of patenting a genetically modified organism like any other creation makes at least some sense. As it is it's yet another example of the patent system not working well with modern "technologies", same as software patents.
@@Meatball2022 literally never happened.
I think the idea makes sense mostly for a private economy - that is, those corporations *need* to make money, and making a plant once and selling it off with no one buying it again doesn't work well.
That said, food production like that could pretty easily be a governmental responsibility, in which case it wouldn't need to turn a profit - just seems we don't have an interest in that model.
An option could just be to reduce the length of time on patents - then there's a period of time to make money, but it then gets to really benefit everyone fully.
So big brother can control what we eat
Thats rule will make you more in chaos