Video

You must choose interactive mode molecular modelling for multiple target sequence and custom template structure uploads. swissmodel.expasy.org/interactive#structure

My pleasure ☺️

It is just like a molecular visualisation tool.

@@AKBIT yes sir iam also a biotech student iam talking about the time it took to simulate

@@AKBIT yes sir iam also a biotech student iam talking about the time it took to simulate

Actually I have downloaded the molecular dynamics trajectories file from the database for the visualisation. Usually MD simulation time depends on the molecule size, movement and system configuration.

Watch this video tutorial for explanation czcams.com/video/m62lg6ZInAI/video.html

My pleasure 😊

Are you using Chimera or ChimeraX?

@@AKBIT You are right, I was using ChimeraX. I am now trying to use PyRx for docking with ChimeraX, but it doesn't recognize my cxs file to open it.

ChimeraX does not have an interface to AutoDock Vina program. UCSF Chimera and UCSF ChimeraX are two different programs; you would need to get Chimera to use this feature.

If you are trying to use PyRx with AutoDock Vina, watch this video tutorial czcams.com/video/F7-2n8Clb68/video.html

Thank you for your valuable feedback 😊

Thank you for the valuable feedback.

!?

Absolutely. Through the Modeller software.

Yes. But, based on the database availability.

Could you translate in English?

You’re welcome 😊

UCSF ChimeraX is the best alternative free software.

Thanks for your feedback 🙂

It is not possible to customize dots color.

Thanks for your feedback.

Currently researchers are focusing on artificial intelligence to improve accuracy in structure prediction. So, most of the servers using old methods are deprecated or discontinued their services.

Press 'Ctrl + Shift + I' to show 'Dimensions' menu at top of the page. Select 'Responsive' from the list box. czcams.com/video/5KOL6kZ0W2w/video.htmlsi=dcwDIUu7ygk6Xrjq&t=33

click elements

Sorry, l don't know Hindi 😉

FYI: The exact matching of characters in both sequences is known as identity. For example, APPLE = APPLE Furthermore, the partial matching of characters in both sequences is known as similarity. For example, APPLE ~ MAPLE

What are Gasteiger and Kollman charges? Refer: expertcomputationalchemistry.blogspot.com/2016/08/the-difference-between-kollman-charges.html Where exactly are these charges being added in the protein? Refer page 5: www.csb.yale.edu/userguides/graphics/mgltools/UsingAutoDockWithADT.pdf How can I determine the location of these charges in the protein? Compare the protein before and after adding charges to find the difference. It will be present in the PDBQT file.

Yes, sure. I'll post soon.

Thanks sir

Nice

First you have to learn the basics of bioinformatics (theory aspect). Later, try simple practical like database, sequence alignment, molecule visualization, etc. After you are familiar, try molecular modeling, drug designing, docking, etc. If you are interested, you can also learn programming languages simultaneously or later. You must go on step-by-step.

@@AKBIT Thanks 🙏🏽 a ton Sir for responding... Please guide as to how to deepen the theory??? And which languages are necessary

'Essential Bioinformatics' by 'Jin Xiong' book is best for beginners www.amazon.in/Essential-Bioinformatics-Jin-Xiong/dp/0521706106/ www.researchgate.net/profile/Debabrata-Samanta-5/post/Bioinformatics-Which-book-should-I-read-to-understand-bioinformatics-from-the-very-beginning/attachment/5e0ddd59cfe4a777d4002f7f/AS%3A842868579106817%401577966937429/download/Xiong+J.+-+Essential+bioinformatics-CUP+%282006%29.pdf

@@AKBITThank you Sir

🤔

Thank you so much for your lovely feedback. 😊

Glad to hear it!

@@AKBIT Right now I‘m trying to save the protein with the docked ligand als pdb file, but I can only save either. Could you help me out?

Watch this video czcams.com/video/dNx_95CZ1Dg/video.html

cactus.nci.nih.gov/cgi-bin/osra/index.cgi

Reference author means the 'name' of the data submitter.

@@AKBIT thanks sir! What to write in? FORWARD PRIMER NAME REVERSE PRIMER NAME Sequence Author Isolation source Isolation place

Can you mention the timeline in the video where you have doubt?

Try the data available at horvath.genetics.ucla.edu/html/CoexpressionNetwork/Rpackages/WGCNA/Tutorials/

www.biob.in/2016/09/installing-latest-pymol-software-for.html

Thanks for your feedback. 🙂

For finding a semi global alignment, the important distinctions are to "initialize the top row and leftmost column to zero" and terminate end at either the bottom row or rightmost column.

That is your choice. If so, you have to perform prior to docking.

You're welcome 😊

You can try rna.informatik.uni-freiburg.de/Teaching/index.jsp?toolName=Smith-Waterman

I have uploaded the updated JAR file. Download it from biogem.org/downloads/software/baba.jar If does not works, run through command-line as java -jar baba.jar from the location where baba.jar file is stored.

​@@AKBIT I think the problem is that some Java files are incompatible with Apple M1/M2 CPUs... I will test the first link... thank you very much ;)

You're welcome 🤗

Try, Right-click the application and Run as Administrator

You're welcome!

Sorry, I can't able to understand your question. Can you explain it more clearly?

Sorry for the inconvenience. In future videos the problem will be rectified. If you have any queries, send mail to ashok.bioinformatics@gmail.com

Thanks for your feedback. In future videos I will rectify it.

RNAComposer allows to work on one RNA molecule of interest at a time; its use is limited upto 500 residues. The input must be in prescribed format, example bellow: >example1 GCUCCUAGAAAGGCGCGGGCCGAGGUACCAAGGCAGCGUGUGGAGC (((((.......((((..(((..........))).))))..))))) Here 'example1' is the task description which begins with the greater-than symbol '>'. Next line is the RNA sequence and third line is the bracket-notations (obtained from the UNAfold web server).

@@AKBIT Thank you sir.

In the result page, under "Results for minimum free energy prediction" section there is a link to download. Example, You can download the minimum free energy (MFE) structure in [Vienna Format| Ct Format].

Happy to hear. Thanks for your feedback ☺️

Pyrx is a graphical interface to the command-line AutoDock Vina program. So, Pyrx is user friendly to perform multiple screenings without much technical knowledge on AutoDock Vina commands.

Thank you for your feedback 😊

It is optional. Usually latest PIP file will be already present in the installed Python directory itself. Continue remaining steps. czcams.com/video/m_J-kaImYeM/video.html

@@AKBIT thank you! i skipped downloading pip file and my pymol still works :)

You're welcome

vina.scripps.edu/wp-content/uploads/sites/55/2020/12/autodock_vina_1_1_2_win32.msi

Installed programs will be at "C:\Program Files (x86)\Vina" directory.

Latest release github.com/ccsb-scripps/AutoDock-Vina/releases/download/v1.2.3/vina_1.2.3_windows_x86_64.exe